ID: 1076077446

View in Genome Browser
Species Human (GRCh38)
Location 10:127546201-127546223
Sequence TAGGTCATCTGGAAGCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076077441_1076077446 27 Left 1076077441 10:127546151-127546173 CCAGGGTTATTTTTAAGAAGTCC No data
Right 1076077446 10:127546201-127546223 TAGGTCATCTGGAAGCTGGTAGG No data
1076077442_1076077446 6 Left 1076077442 10:127546172-127546194 CCAAAGTGTTTCTGACTTCTGAG No data
Right 1076077446 10:127546201-127546223 TAGGTCATCTGGAAGCTGGTAGG No data
1076077440_1076077446 28 Left 1076077440 10:127546150-127546172 CCCAGGGTTATTTTTAAGAAGTC No data
Right 1076077446 10:127546201-127546223 TAGGTCATCTGGAAGCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076077446 Original CRISPR TAGGTCATCTGGAAGCTGGT AGG Intergenic
No off target data available for this crispr