ID: 1076077847

View in Genome Browser
Species Human (GRCh38)
Location 10:127551018-127551040
Sequence GGTGGCATCATGAGTATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076077843_1076077847 9 Left 1076077843 10:127550986-127551008 CCAGAACTGATACATTCCTTTTG 0: 1
1: 0
2: 0
3: 8
4: 221
Right 1076077847 10:127551018-127551040 GGTGGCATCATGAGTATTTCTGG No data
1076077846_1076077847 -7 Left 1076077846 10:127551002-127551024 CCTTTTGCAGTATAAAGGTGGCA 0: 1
1: 0
2: 0
3: 2
4: 112
Right 1076077847 10:127551018-127551040 GGTGGCATCATGAGTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076077847 Original CRISPR GGTGGCATCATGAGTATTTC TGG Intronic
No off target data available for this crispr