ID: 1076079063

View in Genome Browser
Species Human (GRCh38)
Location 10:127561583-127561605
Sequence ATGAATATACAAACGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076079060_1076079063 11 Left 1076079060 10:127561549-127561571 CCAATAATGTAAATTAATTGCAG No data
Right 1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076079063 Original CRISPR ATGAATATACAAACGGGCAA TGG Intergenic
No off target data available for this crispr