ID: 1076080100

View in Genome Browser
Species Human (GRCh38)
Location 10:127572059-127572081
Sequence AAGGATAAGGAGAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076080095_1076080100 23 Left 1076080095 10:127572013-127572035 CCACTAAAATAATAATAAAAGGA No data
Right 1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076080100 Original CRISPR AAGGATAAGGAGAATGAGGC AGG Intergenic
No off target data available for this crispr