ID: 1076083685 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:127606313-127606335 |
| Sequence | GTGTCCAGTTTTAAGTTGGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076083675_1076083685 | 24 | Left | 1076083675 | 10:127606266-127606288 | CCAGGGGTCAACAATGGCTGAGG | No data | ||
| Right | 1076083685 | 10:127606313-127606335 | GTGTCCAGTTTTAAGTTGGTGGG | No data | ||||
| 1076083674_1076083685 | 25 | Left | 1076083674 | 10:127606265-127606287 | CCCAGGGGTCAACAATGGCTGAG | No data | ||
| Right | 1076083685 | 10:127606313-127606335 | GTGTCCAGTTTTAAGTTGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076083685 | Original CRISPR | GTGTCCAGTTTTAAGTTGGT GGG | Intergenic | ||
| No off target data available for this crispr | |||||