ID: 1076083685

View in Genome Browser
Species Human (GRCh38)
Location 10:127606313-127606335
Sequence GTGTCCAGTTTTAAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076083675_1076083685 24 Left 1076083675 10:127606266-127606288 CCAGGGGTCAACAATGGCTGAGG No data
Right 1076083685 10:127606313-127606335 GTGTCCAGTTTTAAGTTGGTGGG No data
1076083674_1076083685 25 Left 1076083674 10:127606265-127606287 CCCAGGGGTCAACAATGGCTGAG No data
Right 1076083685 10:127606313-127606335 GTGTCCAGTTTTAAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076083685 Original CRISPR GTGTCCAGTTTTAAGTTGGT GGG Intergenic
No off target data available for this crispr