ID: 1076089040

View in Genome Browser
Species Human (GRCh38)
Location 10:127663201-127663223
Sequence ATTCTATTCTGATAAATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076089037_1076089040 22 Left 1076089037 10:127663156-127663178 CCTGAATTTTCAAATACCAAATT No data
Right 1076089040 10:127663201-127663223 ATTCTATTCTGATAAATCAAGGG No data
1076089036_1076089040 23 Left 1076089036 10:127663155-127663177 CCCTGAATTTTCAAATACCAAAT No data
Right 1076089040 10:127663201-127663223 ATTCTATTCTGATAAATCAAGGG No data
1076089038_1076089040 6 Left 1076089038 10:127663172-127663194 CCAAATTGCTGTCTCTGAAAAAT No data
Right 1076089040 10:127663201-127663223 ATTCTATTCTGATAAATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076089040 Original CRISPR ATTCTATTCTGATAAATCAA GGG Intergenic
No off target data available for this crispr