ID: 1076089193

View in Genome Browser
Species Human (GRCh38)
Location 10:127665901-127665923
Sequence CATGCAAGACTGCTGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076089193_1076089199 28 Left 1076089193 10:127665901-127665923 CCCTTCTGCAGCAGTCTTGCATG No data
Right 1076089199 10:127665952-127665974 TGGGAATTAAAATTTCACTGAGG No data
1076089193_1076089196 -1 Left 1076089193 10:127665901-127665923 CCCTTCTGCAGCAGTCTTGCATG No data
Right 1076089196 10:127665923-127665945 GAACAAACAAAAGCTAAAGAGGG No data
1076089193_1076089198 9 Left 1076089193 10:127665901-127665923 CCCTTCTGCAGCAGTCTTGCATG No data
Right 1076089198 10:127665933-127665955 AAGCTAAAGAGGGAATACATGGG No data
1076089193_1076089195 -2 Left 1076089193 10:127665901-127665923 CCCTTCTGCAGCAGTCTTGCATG No data
Right 1076089195 10:127665922-127665944 TGAACAAACAAAAGCTAAAGAGG No data
1076089193_1076089197 8 Left 1076089193 10:127665901-127665923 CCCTTCTGCAGCAGTCTTGCATG No data
Right 1076089197 10:127665932-127665954 AAAGCTAAAGAGGGAATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076089193 Original CRISPR CATGCAAGACTGCTGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr