ID: 1076097393

View in Genome Browser
Species Human (GRCh38)
Location 10:127742983-127743005
Sequence CTTTAGGTATGGAGGGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076097393_1076097402 11 Left 1076097393 10:127742983-127743005 CCCCCTACCCTCCATACCTAAAG No data
Right 1076097402 10:127743017-127743039 TCAAATAACCCTTTGAGTTCAGG No data
1076097393_1076097406 28 Left 1076097393 10:127742983-127743005 CCCCCTACCCTCCATACCTAAAG No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data
1076097393_1076097405 24 Left 1076097393 10:127742983-127743005 CCCCCTACCCTCCATACCTAAAG No data
Right 1076097405 10:127743030-127743052 TGAGTTCAGGATTTGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076097393 Original CRISPR CTTTAGGTATGGAGGGTAGG GGG (reversed) Intergenic
No off target data available for this crispr