ID: 1076097406

View in Genome Browser
Species Human (GRCh38)
Location 10:127743034-127743056
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076097398_1076097406 21 Left 1076097398 10:127742990-127743012 CCCTCCATACCTAAAGGCATAGT No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data
1076097393_1076097406 28 Left 1076097393 10:127742983-127743005 CCCCCTACCCTCCATACCTAAAG No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data
1076097397_1076097406 25 Left 1076097397 10:127742986-127743008 CCTACCCTCCATACCTAAAGGCA No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data
1076097396_1076097406 26 Left 1076097396 10:127742985-127743007 CCCTACCCTCCATACCTAAAGGC No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data
1076097399_1076097406 20 Left 1076097399 10:127742991-127743013 CCTCCATACCTAAAGGCATAGTA No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data
1076097394_1076097406 27 Left 1076097394 10:127742984-127743006 CCCCTACCCTCCATACCTAAAGG No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data
1076097401_1076097406 12 Left 1076097401 10:127742999-127743021 CCTAAAGGCATAGTATTTTCAAA No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data
1076097400_1076097406 17 Left 1076097400 10:127742994-127743016 CCATACCTAAAGGCATAGTATTT No data
Right 1076097406 10:127743034-127743056 TTCAGGATTTGACTCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076097406 Original CRISPR TTCAGGATTTGACTCCAGGT AGG Intergenic
No off target data available for this crispr