ID: 1076107625

View in Genome Browser
Species Human (GRCh38)
Location 10:127835816-127835838
Sequence AGACCTGTGTGGGGACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076107625_1076107637 20 Left 1076107625 10:127835816-127835838 CCACCCTGTCCCCACACAGGTCT No data
Right 1076107637 10:127835859-127835881 CAGGGTGATTTTGCTCCATGGGG No data
1076107625_1076107635 18 Left 1076107625 10:127835816-127835838 CCACCCTGTCCCCACACAGGTCT No data
Right 1076107635 10:127835857-127835879 CTCAGGGTGATTTTGCTCCATGG No data
1076107625_1076107633 2 Left 1076107625 10:127835816-127835838 CCACCCTGTCCCCACACAGGTCT No data
Right 1076107633 10:127835841-127835863 ACTCCAGTGGATCTCACTCAGGG No data
1076107625_1076107632 1 Left 1076107625 10:127835816-127835838 CCACCCTGTCCCCACACAGGTCT No data
Right 1076107632 10:127835840-127835862 TACTCCAGTGGATCTCACTCAGG No data
1076107625_1076107636 19 Left 1076107625 10:127835816-127835838 CCACCCTGTCCCCACACAGGTCT No data
Right 1076107636 10:127835858-127835880 TCAGGGTGATTTTGCTCCATGGG No data
1076107625_1076107638 29 Left 1076107625 10:127835816-127835838 CCACCCTGTCCCCACACAGGTCT No data
Right 1076107638 10:127835868-127835890 TTTGCTCCATGGGGAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076107625 Original CRISPR AGACCTGTGTGGGGACAGGG TGG (reversed) Intergenic
No off target data available for this crispr