ID: 1076112701

View in Genome Browser
Species Human (GRCh38)
Location 10:127873074-127873096
Sequence CACTTCCCAGTAGTAGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076112701_1076112704 17 Left 1076112701 10:127873074-127873096 CCAAGGTCTACTACTGGGAAGTG No data
Right 1076112704 10:127873114-127873136 AACCCTTTTATACACACGCAGGG No data
1076112701_1076112703 16 Left 1076112701 10:127873074-127873096 CCAAGGTCTACTACTGGGAAGTG No data
Right 1076112703 10:127873113-127873135 CAACCCTTTTATACACACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076112701 Original CRISPR CACTTCCCAGTAGTAGACCT TGG (reversed) Intergenic
No off target data available for this crispr