ID: 1076113230

View in Genome Browser
Species Human (GRCh38)
Location 10:127877020-127877042
Sequence AGCCAGGTTGAACACTGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076113230_1076113234 26 Left 1076113230 10:127877020-127877042 CCCTATCAGTGTTCAACCTGGCT No data
Right 1076113234 10:127877069-127877091 GATTCTCAAAGTGATTTTCTGGG No data
1076113230_1076113233 25 Left 1076113230 10:127877020-127877042 CCCTATCAGTGTTCAACCTGGCT No data
Right 1076113233 10:127877068-127877090 AGATTCTCAAAGTGATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076113230 Original CRISPR AGCCAGGTTGAACACTGATA GGG (reversed) Intergenic