ID: 1076115089

View in Genome Browser
Species Human (GRCh38)
Location 10:127889898-127889920
Sequence GTGGACACCCACCTCCTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076115089_1076115092 15 Left 1076115089 10:127889898-127889920 CCGAGAAGGAGGTGGGTGTCCAC 0: 1
1: 0
2: 0
3: 33
4: 207
Right 1076115092 10:127889936-127889958 CTCCTAGCAGCTCATTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076115089 Original CRISPR GTGGACACCCACCTCCTTCT CGG (reversed) Intronic
903567994 1:24283524-24283546 GTGGGCACCCACCTGTCTCTGGG - Intergenic
903671503 1:25038374-25038396 GTGGAGCCCCACCTCCTCCTGGG - Intergenic
906295757 1:44648111-44648133 CTGGAGCCCCACCTCCTCCTGGG + Intronic
906640163 1:47436963-47436985 CTGGACACCCCCCACCTTCCTGG - Exonic
915502353 1:156328027-156328049 CTGGACCCCCACCTCCCTCCCGG - Intronic
915607855 1:156964826-156964848 GTGCTCACCCACCACCTTCTGGG - Intronic
916538438 1:165728035-165728057 TTGGCCCACCACCTCCTTCTGGG - Exonic
916722163 1:167492699-167492721 GTGGTTTCCCACCTCCTTCTAGG - Intronic
917742376 1:177973181-177973203 GTGAACACCCACCTAGATCTAGG + Intronic
919633012 1:199977264-199977286 CTGGGCACCCACCTCCTGCCAGG - Intergenic
919800925 1:201354211-201354233 TTGGCCAGCCTCCTCCTTCTTGG - Intergenic
920035697 1:203063955-203063977 GTGGACCCGCAGGTCCTTCTTGG - Exonic
924076134 1:240339118-240339140 CTGGCCACTCACCTCCTGCTGGG + Intronic
1065138572 10:22698017-22698039 GTGGACAGCGACCTGCTTCTGGG + Intronic
1065782586 10:29183771-29183793 CTGGACACACAACTCCTTTTAGG + Intergenic
1067034500 10:42903082-42903104 GTGGCAATCCACCTCCTTCAAGG - Intergenic
1067095066 10:43294674-43294696 GTGGTCACCCACCCCCTCCTGGG + Intergenic
1067095099 10:43294761-43294783 GTGGTCACCCACCCCCTCCTGGG + Intergenic
1067278603 10:44854945-44854967 CTGGTCACCCTCCTCATTCTGGG - Intergenic
1072448350 10:95518922-95518944 GTGCAGCCCCACCTCCCTCTGGG + Intronic
1073449379 10:103600624-103600646 CTGAACACCCTCCTCCTTCCTGG + Exonic
1075428619 10:122362562-122362584 GCAGCCACCAACCTCCTTCTGGG - Intergenic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076428253 10:130382575-130382597 GTGGCAACCCAGATCCTTCTGGG - Intergenic
1076606843 10:131694865-131694887 GTGGCCACACAGCTCCTTCTGGG - Intergenic
1076696953 10:132251585-132251607 GTGGGCACCCACCACCCTCTTGG - Intronic
1076868732 10:133182357-133182379 GTGGACACGCACCTGCATCCTGG - Intronic
1076875840 10:133215133-133215155 GTAGACGCCCACCCCCTCCTGGG + Intronic
1077223020 11:1425743-1425765 TTGGGAACCCACCCCCTTCTGGG + Intronic
1078443577 11:11387334-11387356 GTGGCCACACCCCTCCTTCCTGG + Intronic
1078759855 11:14243186-14243208 GTGTACAGCCACCTCTCTCTGGG - Intronic
1082768513 11:57187400-57187422 GTGGCCACCAACTTCCTCCTGGG + Exonic
1083764662 11:64836105-64836127 CTGGTCACTCACCTCCCTCTGGG + Exonic
1083865482 11:65451211-65451233 GCTGACCCCCACCTCCTTCCCGG - Intergenic
1084849588 11:71928303-71928325 ATGGCCACCCTCCTCCCTCTCGG + Intronic
1084958304 11:72703106-72703128 GTGGGCCCCCTACTCCTTCTTGG - Intronic
1085515106 11:77107124-77107146 GTGGGCACCCCCTGCCTTCTTGG - Intronic
1087497017 11:98904458-98904480 GGTGACACCCAGCTCCATCTTGG - Intergenic
1089280187 11:117368662-117368684 GGCAACTCCCACCTCCTTCTTGG + Intronic
1089631267 11:119785919-119785941 ATGGATACCCACCTCTCTCTGGG - Intergenic
1091754522 12:3042860-3042882 GTGGACAGTCACCTCCTTACAGG + Intergenic
1092150045 12:6241705-6241727 GTGGACAGCCAGCTCCTTTTGGG - Intergenic
1094143036 12:27200124-27200146 TTGGTTACTCACCTCCTTCTTGG + Intergenic
1096614447 12:52823875-52823897 GTAGAGTCCCACCTGCTTCTTGG + Exonic
1096856635 12:54488384-54488406 GTTGACCCCCACCTCCCTCCCGG + Intergenic
1102019759 12:109674092-109674114 ATGGGCACCCACATCCTTATAGG + Intergenic
1102191866 12:110994820-110994842 GTGGACAGCCACCTGCTTGCTGG + Intergenic
1102469539 12:113152013-113152035 GTGGGGGCTCACCTCCTTCTGGG - Exonic
1104776310 12:131392122-131392144 GTGGATACCCACATCCTTTTAGG - Intergenic
1106251712 13:27986974-27986996 GTGGACACTCACCCACTTCTGGG - Intronic
1108608568 13:52063889-52063911 GCTGACCCCCACCTCCTTCCCGG - Intronic
1111364470 13:87223770-87223792 GGTAACACCCTCCTCCTTCTTGG + Intergenic
1118184189 14:63522800-63522822 GGTGACCCCCACCTCCTTCCTGG - Intronic
1123992520 15:25694149-25694171 GTGGCCACTCGCCTCCTTCCAGG - Intronic
1123994273 15:25707326-25707348 GTCCACCCCCACCTCCATCTCGG - Intronic
1124335032 15:28849741-28849763 GTTGACCCCCACCTCCCTCCCGG + Intergenic
1124553996 15:30708918-30708940 GTGGGCACCCACCCCCATCTGGG + Intronic
1124677251 15:31696753-31696775 GTGGGCACCCACCCCCATCTGGG - Intronic
1127484427 15:59406025-59406047 ATTGACAGCCACCTCTTTCTGGG - Intronic
1128527114 15:68420119-68420141 GGGCACTCCCAGCTCCTTCTTGG + Intronic
1129141785 15:73605200-73605222 GTAGACATCCCCCTCCTTCATGG - Intronic
1129675057 15:77628088-77628110 GGGGACACTCATCTCCTGCTGGG + Intronic
1129702140 15:77774173-77774195 GTGCACACTCACCACCCTCTAGG - Intronic
1132731722 16:1366210-1366232 GGGGACAGCCACCTCCTGCTGGG - Intronic
1132930669 16:2457516-2457538 TGGGGCACCCACTTCCTTCTGGG + Exonic
1134100682 16:11449483-11449505 GATGACACCCACCTCTTCCTAGG - Intronic
1134156180 16:11845110-11845132 GTGAAGATCCACCTCATTCTTGG - Intronic
1135111105 16:19691461-19691483 GAGGGCACCCACCTCGTCCTTGG - Exonic
1136428417 16:30183951-30183973 CCGGCCACCCACCTCCATCTTGG - Intronic
1137482478 16:48864211-48864233 GGTGACACCCACCCACTTCTGGG - Intergenic
1137564277 16:49523612-49523634 GTGGGCACCCACCTGCAGCTCGG + Exonic
1137601947 16:49762287-49762309 GTGGAGGCCCACTTCCTTCTGGG - Intronic
1138704527 16:58901224-58901246 GTGCACAGCCACCTTATTCTAGG + Intergenic
1138938723 16:61763012-61763034 TTGGACACCAACTTCCTGCTGGG + Intronic
1139476178 16:67203573-67203595 GCGGACACTCACCTCCCGCTTGG - Exonic
1139781190 16:69352796-69352818 TTCAACACCCACCTCCTTCATGG + Intronic
1142265185 16:89061173-89061195 CTGAGCACCCACCTTCTTCTGGG + Intergenic
1142720665 17:1773733-1773755 GTGGCCAACGACATCCTTCTAGG + Intronic
1142963203 17:3564307-3564329 GGTGACCCCCACCTCCTTCCTGG + Intergenic
1143054158 17:4150186-4150208 GTGCCCATCCATCTCCTTCTGGG - Intronic
1143196561 17:5080268-5080290 ATGGACATCCACCTTCATCTGGG - Intronic
1147473289 17:40684758-40684780 CTGGAGACCCAGCTCCTTCAAGG - Intergenic
1149877957 17:60257149-60257171 CTGGACTCCCATCTCCTTTTTGG - Intronic
1150067706 17:62125392-62125414 GTGGTCACCCACCTCTGTCAAGG - Intergenic
1151954591 17:77374026-77374048 GTGGACAGCCGCGTCCTGCTCGG + Intronic
1152378669 17:79931089-79931111 GTGGCCACCCACCTGCTCCCAGG - Intergenic
1152743561 17:82029175-82029197 GTGGGCACTCACCTCCTCCAGGG - Exonic
1152878093 17:82799771-82799793 GTGAACACAGACCTCCCTCTTGG + Intronic
1153913071 18:9721006-9721028 GAGGGCAGCCACCTCCTTTTGGG + Intronic
1155542592 18:26884051-26884073 GTGGACACCCCCCGCCATATGGG - Intergenic
1157516656 18:48316094-48316116 CTGGACACCCGGCTCCTGCTGGG + Intronic
1158602000 18:58863740-58863762 GCGCACACCCACCCCCTTCCCGG - Intronic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1160239467 18:77112704-77112726 GTGGCCACCCACGTGCTCCTAGG - Intronic
1160801913 19:974235-974257 GGGGACCCCCACTTCCTTCTCGG + Exonic
1160828195 19:1090356-1090378 GGGCACAGCCACCTCCTGCTGGG + Intronic
1160930972 19:1569167-1569189 GTGGAGCCCCACCCTCTTCTGGG + Intergenic
1162094757 19:8303793-8303815 GGGGACACCCACTGCCTGCTGGG - Intronic
1162525519 19:11204044-11204066 GTGGACAGCCACCTGCCTCTGGG - Intronic
1163292130 19:16385708-16385730 GTGGACACCCCCTTTCTTTTGGG - Intronic
1165369696 19:35397054-35397076 GGGGACTCCCACGTCCTTCCTGG + Intergenic
1168420318 19:56197722-56197744 CTGGACACTCACCTCCTTCCCGG + Exonic
1168424525 19:56228240-56228262 CTGGACACTCACCTCCTTCCCGG + Exonic
926115437 2:10210167-10210189 ATGGACTCCCACCTCCTTGTGGG + Intronic
926675038 2:15612186-15612208 GGTGACCCCCACCTCCTTCCTGG + Intronic
929151919 2:38755978-38756000 GCTGACCCCCACCTCCTTCCCGG + Intronic
929572143 2:43029374-43029396 GTGGCCACCCACCTAGGTCTGGG - Intergenic
931809965 2:65845308-65845330 CTGGACACACACCTCCTATTTGG + Intergenic
933984107 2:87576185-87576207 GTGAAGACCCACCTCCCACTTGG - Intergenic
935746835 2:106196215-106196237 TGGGACACCAACCGCCTTCTGGG - Intergenic
936309747 2:111374611-111374633 GTGAAGACCCACCTCCCACTTGG + Intergenic
939733424 2:145813699-145813721 GTGGAGAGCCCCCTCATTCTTGG + Intergenic
939973892 2:148694269-148694291 GTCCACTCCCAACTCCTTCTCGG - Intronic
942666574 2:178325805-178325827 GCTAACAGCCACCTCCTTCTAGG - Intronic
947796061 2:232894722-232894744 GGGGACAGCCACCTCCCTCAGGG - Intronic
948654610 2:239468953-239468975 CTGGGCTCCCACCTCCTCCTGGG + Intergenic
1170945543 20:20887988-20888010 GTTGACAACCACCTCCTGCCCGG - Intergenic
1172401993 20:34658889-34658911 GTTGACCCCCACCTCCCTCCTGG - Intronic
1172566052 20:35931362-35931384 GTGGCCACCCACCAGCTTCTTGG + Exonic
1172722804 20:37012680-37012702 GTTGACCCCCACCTCCCTCCCGG - Intronic
1172754735 20:37275432-37275454 GTGGACACTGACCTTCTACTAGG + Intergenic
1174167043 20:48592523-48592545 ATGGCCACTCACCTCCTGCTGGG + Intergenic
1175669655 20:60890949-60890971 GGGGACAGACACCTCCTTCAGGG + Intergenic
1175908638 20:62394116-62394138 GTGGACACCCAGCGCCGTCAGGG - Intronic
1175975989 20:62710770-62710792 CTGGACACCAGCCTCCTGCTCGG - Intronic
1176386143 21:6139361-6139383 GTGGACACCTACCTCATTTGGGG - Intergenic
1177491183 21:21828354-21828376 TAGCACACCCACCTCCTTTTTGG - Intergenic
1178994593 21:37387076-37387098 TTGCACACCCACCTCCATTTAGG - Intronic
1179031126 21:37720497-37720519 CTGGACACCCTCCTCCTTCAAGG - Intronic
1179298965 21:40089673-40089695 GTGGACATCCCCATCCCTCTAGG + Intronic
1179737330 21:43398891-43398913 GTGGACACCTACCTCATTTGGGG + Intergenic
1181830321 22:25555328-25555350 GTAGACACCCTCCACCTTCATGG - Intergenic
1182131560 22:27856772-27856794 GTGGACACCCACCAGCTGCTTGG + Intronic
1182685443 22:32119553-32119575 GAGGGCACCCTCCTCCTTCTGGG - Intergenic
1183390978 22:37545687-37545709 GGGGTCACCTACCTCCTTTTGGG + Intergenic
1183479015 22:38052741-38052763 GAGGACACCCACCTACTCCCAGG - Intergenic
1183730326 22:39614836-39614858 GAAGACAGCCACCTCCTCCTGGG + Intronic
949853410 3:8440111-8440133 GGTGACCCCCACCTCCTTCCTGG - Intergenic
951550499 3:23871512-23871534 GCTGACCCCCACCTCCCTCTCGG + Intronic
952253788 3:31678422-31678444 CTGCACAGCCACCTCCTTGTCGG + Intronic
952308894 3:32169870-32169892 GCTGACCCCCACCTCCTTCCCGG - Intergenic
953652745 3:44821303-44821325 GGTGACCCCCACCTCCTTCCTGG + Intronic
960218719 3:115077029-115077051 CCGGACACTCACCTCCTGCTGGG + Intronic
960952502 3:123008795-123008817 GTTGACACCTACCTGCTGCTTGG - Intronic
961789088 3:129363455-129363477 GTTGACTCCCACCTCCCTCCCGG + Intergenic
962353884 3:134677489-134677511 GTGCCCACCTACCTCCATCTGGG + Intronic
964204090 3:154151758-154151780 GTGGACACCCAGCTGCTGATGGG - Intronic
964819396 3:160754709-160754731 GTGGTCTCCCACCACCTCCTCGG - Intergenic
967247495 3:187502690-187502712 GGGGACACCCACCTTCTTAAAGG + Intergenic
968006632 3:195247564-195247586 ATGGCCCCCCACCTCCTTCCTGG + Intronic
970869133 4:20794358-20794380 CTGGCCACTCACCTCCTGCTGGG + Intronic
972551759 4:40141266-40141288 GGTGACCCCCACCTCCTTCCTGG + Intronic
978603790 4:110456811-110456833 GTGGACTCCCAACTGCTCCTGGG + Intronic
983941535 4:173538445-173538467 GTGGACCCCCAGCTCCGTCTCGG + Intergenic
985040658 4:185888476-185888498 GTGTAACCCCACCTCCATCTTGG + Intronic
985485226 5:145053-145075 GTGCAGAGCCACCTCCTTCTTGG + Intronic
985824099 5:2180210-2180232 GTGGCCCCCCACCACCTTCACGG + Intergenic
985868234 5:2533110-2533132 GTGGTCACCCACCTTCTCCTAGG - Intergenic
986119270 5:4816485-4816507 TTGTACACCGACCTCGTTCTCGG - Intergenic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
990343555 5:54849188-54849210 CTGGACACCTGCTTCCTTCTGGG + Intergenic
990681105 5:58245286-58245308 GTGCACATCCTCCTCTTTCTGGG + Intergenic
991477038 5:67033116-67033138 TTGGAAACCCATCTCATTCTTGG + Intronic
992672934 5:79077602-79077624 GTGGACACCAACCTGCGTCTGGG - Exonic
992796649 5:80259600-80259622 GAGGTCACCCAGCTACTTCTTGG - Intergenic
1002468107 5:179417889-179417911 GTGGTCACCCAGCTGCTTCTGGG - Intergenic
1004737999 6:18427610-18427632 TGGGAGACCCACATCCTTCTCGG - Exonic
1007864611 6:44955226-44955248 GTGGTGATCCACCTCCTTCAAGG - Intronic
1009366415 6:62860974-62860996 GTGGACACCCCCCGCCATATGGG - Intergenic
1009366438 6:62861055-62861077 GTGGACACCCCCCGCCATATGGG - Intergenic
1010731903 6:79400025-79400047 GTGAATACCCACCAACTTCTAGG + Intergenic
1017447704 6:154523122-154523144 GTAGACACTCAACTCCTTGTTGG - Intergenic
1019744679 7:2692942-2692964 GTGTACACCCACCTCTGTCTGGG + Intronic
1024220244 7:47281408-47281430 GGGGTCACCCCTCTCCTTCTGGG + Intronic
1030143280 7:106327254-106327276 GTGTATTCCCTCCTCCTTCTAGG + Intergenic
1032080211 7:128854902-128854924 GTGGACGCCCACCTGGTTCCTGG - Exonic
1035397820 7:158546641-158546663 GTAGTCACCCACCTGCTACTCGG - Intronic
1037422396 8:18716952-18716974 CTGGACACCCACCTCTTGCCAGG + Intronic
1038259944 8:25984161-25984183 TGGGAGACCCAGCTCCTTCTCGG - Intronic
1041087716 8:54272015-54272037 ATGGACAACAACCTCCATCTCGG + Intergenic
1041251296 8:55937215-55937237 GAGGACATCCACCACCTTGTTGG - Intronic
1041464590 8:58145938-58145960 GGAGACTCCCACCTCCTTCAGGG + Exonic
1043669585 8:82865370-82865392 GTGGACAACCACTTCCAGCTGGG - Intergenic
1049177415 8:141202409-141202431 GCTGACCCCCACCTCCTTCCCGG + Intergenic
1049424551 8:142532298-142532320 GGGGACACCAACCTGCTTCCCGG - Intronic
1049697925 8:143992701-143992723 GTGGACACCCAGCTGCTACTGGG + Exonic
1051764983 9:20513692-20513714 GTGTACAACCACCTCCCTCATGG - Intronic
1052849557 9:33368656-33368678 GTAGGCACCCCTCTCCTTCTGGG - Intronic
1052881076 9:33601144-33601166 GCTGACTCCCACCTCCCTCTCGG - Intergenic
1052941927 9:34137655-34137677 GGTGACCCCCACCTCCTTCCTGG - Intergenic
1053860801 9:42384860-42384882 GCTGACATCCACTTCCTTCTTGG - Intergenic
1055242116 9:74197701-74197723 GCTGACACCCACCTCCCTCCCGG - Intergenic
1055333802 9:75211012-75211034 GTGGGCACCTAACGCCTTCTAGG - Intergenic
1055846407 9:80568903-80568925 CTGGCCACTCACCTCCTGCTGGG + Intergenic
1056562239 9:87741279-87741301 GCGGTCCCCCACCTCCTTCACGG - Intergenic
1056762981 9:89427947-89427969 GGGGAAACACACCTCCTTCCTGG - Intronic
1062424056 9:136497982-136498004 GTGGCCACCAAGCTCCTTCCTGG + Intronic
1062441831 9:136573366-136573388 CTGGTCCTCCACCTCCTTCTTGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1185796159 X:2966154-2966176 GTGGAAACCACCCTACTTCTGGG + Intronic
1186521236 X:10208616-10208638 GTGGGGACCCATGTCCTTCTGGG + Intronic
1189503736 X:41590043-41590065 GGGCAAACCCAACTCCTTCTAGG + Intronic
1189505889 X:41612516-41612538 GCTGACCCCCACCTCCTTCCCGG - Intronic
1189968570 X:46396135-46396157 GCTGACCCCCACCTCCTTCCCGG + Intergenic
1192180190 X:68911412-68911434 GTGCACAGCAGCCTCCTTCTGGG + Intergenic
1197452969 X:126641574-126641596 GCTGACCCCCACCTCCCTCTCGG - Intergenic
1198870991 X:141177084-141177106 GTGGACACGCACTTCCTGCGAGG - Exonic
1200955093 Y:8936912-8936934 GTGGAAACATACCTCCTGCTTGG - Intergenic
1201575103 Y:15454953-15454975 GTGGACAACCACTACCTTGTAGG + Intergenic