ID: 1076115254

View in Genome Browser
Species Human (GRCh38)
Location 10:127891126-127891148
Sequence TGTCAAGGAGAGCCCTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 5, 3: 22, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076115254_1076115265 30 Left 1076115254 10:127891126-127891148 CCCCTTCAGGGCTCTCCTTGACA 0: 1
1: 1
2: 5
3: 22
4: 231
Right 1076115265 10:127891179-127891201 TGCTCACCTGCATGCACACAGGG No data
1076115254_1076115264 29 Left 1076115254 10:127891126-127891148 CCCCTTCAGGGCTCTCCTTGACA 0: 1
1: 1
2: 5
3: 22
4: 231
Right 1076115264 10:127891178-127891200 ATGCTCACCTGCATGCACACAGG No data
1076115254_1076115257 -9 Left 1076115254 10:127891126-127891148 CCCCTTCAGGGCTCTCCTTGACA 0: 1
1: 1
2: 5
3: 22
4: 231
Right 1076115257 10:127891140-127891162 TCCTTGACAAGTGCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076115254 Original CRISPR TGTCAAGGAGAGCCCTGAAG GGG (reversed) Intronic
901925922 1:12565953-12565975 TGCTAAGCAGAGCCCTAAAGAGG - Intergenic
903370950 1:22835833-22835855 TGCCCAGGACAGCCCTGATGGGG + Intronic
905179054 1:36155666-36155688 TCACAAGGAGACCCCTGAAAGGG - Intronic
906475128 1:46164431-46164453 AGTCAAGGAGACCTGTGAAGAGG - Intronic
907386853 1:54131507-54131529 TGTCAAGAAGAGCTCTGAGAAGG + Intergenic
909344285 1:74567353-74567375 TCTCAAGGACAGCCCGGAAGAGG - Intergenic
912436872 1:109668240-109668262 TGTCAGGGACAGCCCTGAAGAGG - Intronic
912454926 1:109790990-109791012 TGGCTAGCAGAGCCCTGAGGAGG - Intergenic
912496942 1:110097956-110097978 TGTGGAGGAGGGCTCTGAAGTGG - Intergenic
912919206 1:113849448-113849470 TGTCAGGGAAAACCCTGAATAGG - Intronic
913376413 1:118157487-118157509 AGGAAAGGAGAGCCCTGGAGTGG - Intronic
914777532 1:150751652-150751674 TGTGAGAGAGAACCCTGAAGAGG - Intronic
915898506 1:159829509-159829531 TGTTAAGCTGAGCCTTGAAGAGG - Intronic
918150980 1:181798178-181798200 TGTCAGGGAGAGGCCTGAGCTGG - Intronic
918955242 1:191199109-191199131 GGTCAGGGTCAGCCCTGAAGAGG - Intergenic
919463772 1:197908861-197908883 TGTCACGGAGGACCCTGATGTGG + Intergenic
919664021 1:200274977-200274999 TGTCATTGAGAGTCCTGAATGGG - Intergenic
920850680 1:209626081-209626103 TGTCAGGGAGAGCCCTGAAGAGG + Intronic
921228126 1:213040875-213040897 TTTCTAGGAGAGCCCTGACTAGG + Intergenic
921333974 1:214067831-214067853 TGGCAAACAGAGCCCTGATGGGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923034567 1:230276573-230276595 TGTCAGGGAGACGCCTGCAGAGG + Intronic
923850839 1:237792602-237792624 AGGCCAGGACAGCCCTGAAGGGG - Intronic
923894695 1:238256672-238256694 TGTCAAGGACAGACATGAAAAGG - Intergenic
1064112492 10:12551022-12551044 TGTCAAAGAGATTCCTGAACAGG - Intronic
1066010647 10:31191075-31191097 TCTCAAGGAGCTCCCAGAAGAGG + Intergenic
1068489230 10:57701007-57701029 GGCCAAGAAGAGCCCAGAAGTGG + Intergenic
1069279953 10:66642968-66642990 TGTAAAGGAAAGCCTTGAAAGGG + Intronic
1073598702 10:104825065-104825087 TGTCAGTGAGAGGCCTGATGAGG + Intronic
1074844321 10:117383770-117383792 TCTCAAGAAGAGCTCAGAAGGGG - Intergenic
1076115254 10:127891126-127891148 TGTCAAGGAGAGCCCTGAAGGGG - Intronic
1079358380 11:19749324-19749346 TGTGAATGACAGCCTTGAAGAGG - Intronic
1080972820 11:37300003-37300025 TGTCAGGGAGACACCAGAAGAGG - Intergenic
1082733047 11:56824092-56824114 TGGCAAGGAGAATCCTAAAGGGG - Intergenic
1083158576 11:60840847-60840869 AGTCAAGGAGACCCCTGCAGGGG - Intergenic
1083234594 11:61343531-61343553 TGTCACGGTCAGCCCTGACGGGG - Intronic
1084995067 11:72968529-72968551 CTTAATGGAGAGCCCTGAAGAGG + Intronic
1086217293 11:84399272-84399294 TAAAAAGGAGACCCCTGAAGAGG - Intronic
1086771681 11:90774898-90774920 TGTCAGGGTTAGACCTGAAGAGG + Intergenic
1087430141 11:98043355-98043377 GGTAAAGAAGAGGCCTGAAGAGG - Intergenic
1088004845 11:104927453-104927475 GGTCAGGGTAAGCCCTGAAGAGG - Intergenic
1088708010 11:112481090-112481112 TGTCAAGAAGAACCCAGATGTGG + Intergenic
1088809839 11:113384794-113384816 TGTCACGGAGAACCCTGGACAGG - Intergenic
1088828900 11:113518460-113518482 TCACAAAGAGAGCCCTGAACGGG - Intergenic
1090737805 11:129626175-129626197 TCTGAAGGAGATCCCTGGAGGGG + Intergenic
1090933882 11:131324482-131324504 GGTCAAGGAGAGACATGAAGTGG - Intergenic
1091689922 12:2588952-2588974 GGACAAGGAGAGCCATGAGGTGG + Intronic
1091789990 12:3266615-3266637 TGACCAGGAGAGCCCTGAAGTGG + Intronic
1091896720 12:4110902-4110924 TGGCAAGGAGATCCCTGTGGAGG + Intergenic
1092443169 12:8527441-8527463 TGTCAAGGTTAGGCCTGAAGAGG + Intergenic
1097387853 12:58971757-58971779 TCTAAAGGAGAGCCGTGAAGTGG - Intergenic
1098469418 12:70826442-70826464 TTTCAAGGAGTTCCCAGAAGGGG - Intronic
1098536323 12:71597440-71597462 TGTGAGAGAGAGCCCAGAAGGGG - Intergenic
1099333947 12:81329713-81329735 TGTCAAAGAAAACCCTGAAGGGG + Intronic
1099727338 12:86448884-86448906 TGTCAAGGAAAGCCAAGAATTGG + Intronic
1100097441 12:91058907-91058929 TGTCAAAGAGCACCGTGAAGAGG + Intergenic
1101388935 12:104282630-104282652 TGTGAAGGAGAGCAATGAAATGG + Intronic
1105754658 13:23453277-23453299 TGAAAAGGAGAGTCATGAAGAGG - Intergenic
1106647738 13:31654865-31654887 TGTTAAGGAGAGCCCAATAGGGG + Intergenic
1106751241 13:32770539-32770561 TGTCAAGGAGAGCACAGCAGAGG + Exonic
1113643174 13:111972854-111972876 AGGCAAGGAGAGGACTGAAGAGG + Intergenic
1115944727 14:38646603-38646625 TGTCAATCAGTGTCCTGAAGTGG - Intergenic
1119000115 14:70873911-70873933 TGAGAAGTAGGGCCCTGAAGAGG + Intergenic
1120292334 14:82590878-82590900 TATCAAGAAGAGCCTTTAAGAGG + Intergenic
1120308892 14:82805244-82805266 CGTCAAAGAGAGCTCTGTAGGGG - Intergenic
1120365361 14:83561645-83561667 GGTCAAGGTCAGGCCTGAAGAGG - Intergenic
1121876603 14:97458753-97458775 TGTCACGGGGAGCCCGGAAGCGG - Intergenic
1122325618 14:100879427-100879449 TGTCAAAGAGAGGACAGAAGAGG - Intergenic
1124046531 15:26155752-26155774 GGTCAAGGTCAGGCCTGAAGAGG + Intergenic
1125780295 15:42259740-42259762 GGTCCAGGAGAGACCTGAGGAGG + Intronic
1128505735 15:68271012-68271034 AGACAAGGAGAGCTCTGAAGAGG - Intergenic
1128548284 15:68581724-68581746 TATGAAGGAGAACCCTAAAGAGG + Intronic
1129178227 15:73855274-73855296 TCTCCAGGAGAGCCCTGAAGGGG + Intergenic
1132605879 16:793535-793557 AGTCAAGGGGCGCCCTGGAGAGG - Intronic
1132728696 16:1350067-1350089 TGCCAAGGAGAGCCCCCAGGAGG - Exonic
1133596877 16:7302415-7302437 TGTCGGGGTGAGCCCTGAGGAGG + Intronic
1136317383 16:29462258-29462280 TGGCAAGGAAAGCCAGGAAGGGG + Intronic
1136431958 16:30201602-30201624 TGGCAAGGAAAGCCAGGAAGGGG + Intronic
1138177017 16:54909625-54909647 GGCCAAGGAGAGCACTGAGGTGG + Intergenic
1138185363 16:54972622-54972644 GGCCAAGGAGAGCACTGAGGTGG - Intergenic
1139932744 16:70542401-70542423 TCTCAAGGAGGAACCTGAAGTGG + Intronic
1140714264 16:77707806-77707828 TTTCTAGGAGAGCCCTCAACAGG + Intergenic
1142912771 17:3110112-3110134 TGTGAAGCAGAGAACTGAAGGGG - Intergenic
1143165226 17:4894164-4894186 TGTCCTGTAGACCCCTGAAGAGG + Exonic
1143250736 17:5521392-5521414 TGTACAGGAGAACCTTGAAGTGG - Intronic
1146059407 17:29596586-29596608 TGGCAACCAGAACCCTGAAGTGG + Intronic
1147732143 17:42610399-42610421 TGTCAAGGGGAGTCCAGGAGGGG - Intronic
1147739102 17:42660125-42660147 TGTCAAGGGGAGTCCAGGAGGGG - Intronic
1152317435 17:79589288-79589310 AGCCAAGGAGAGCCCTGGGGCGG - Intergenic
1156261763 18:35451239-35451261 TGTCTAGGAGAGCCTTGACTAGG + Intronic
1157400146 18:47380483-47380505 TGTGAAGCAGAGGCCAGAAGTGG + Intergenic
1157914993 18:51655752-51655774 TGTCAGGGTGGGCTCTGAAGTGG - Intergenic
1161838062 19:6661150-6661172 TGTCCAGGGGAGCCCGGAACGGG + Intergenic
1162182513 19:8879831-8879853 GGTCAGGGTTAGCCCTGAAGAGG - Intronic
1163786465 19:19277342-19277364 ACTCAAGGACAGCCTTGAAGGGG + Intronic
1164163857 19:22650665-22650687 TGTCAGGGTCAGGCCTGAAGAGG + Intronic
1164532427 19:29058571-29058593 GGTTAAGGAGAGCCATGAGGAGG + Intergenic
1164745728 19:30611311-30611333 AGTGAGGGGGAGCCCTGAAGTGG + Intronic
1165931641 19:39362928-39362950 TGTCAAGCAGAGCCTGAAAGTGG - Intronic
1168271058 19:55250036-55250058 TGTGCAGGAGACACCTGAAGTGG - Intronic
924962027 2:44564-44586 TCTCAAAGACAGCCCTGAAAAGG + Intronic
925202662 2:1981535-1981557 GGTCAAGGAGGTGCCTGAAGTGG + Intronic
932969605 2:76524507-76524529 AGTCAAGGAGCTCCCTCAAGAGG - Intergenic
933188319 2:79303640-79303662 TCTCTAGGAGAGCCCTGATGAGG + Intronic
934553979 2:95277877-95277899 GTTCATGGAGAGGCCTGAAGGGG - Intronic
935266178 2:101396143-101396165 TGTCTAGGAGAGCCCTGATTGGG - Intergenic
936759615 2:115760572-115760594 TGTGAAGGAGAGCCCTCAAGAGG + Intronic
937043257 2:118836893-118836915 GGGCAAGGAGAGCCCTGCTGTGG + Intergenic
937840712 2:126521531-126521553 TGGCAAGGTGTCCCCTGAAGGGG + Intergenic
942339614 2:174930189-174930211 TTTCTAGGAGAGCCCTGACCAGG + Intronic
944385120 2:199155206-199155228 GGTCAGGGTTAGCCCTGAAGAGG - Intergenic
944762265 2:202828687-202828709 TGTCAATCAGAGCTCTGAATAGG - Intronic
945107250 2:206327739-206327761 TTTCAAGGGCAGTCCTGAAGGGG + Intergenic
946290273 2:218739107-218739129 TGAGAAGGAGAGACCTGAGGAGG + Exonic
946299944 2:218816798-218816820 GGTCAGGGAGGGCCCTGCAGAGG - Intergenic
948688120 2:239684163-239684185 GGGAAAGGAGAGGCCTGAAGTGG - Intergenic
1170052224 20:12158740-12158762 TGTCTAGAAGAGCCCTGACCTGG + Intergenic
1172193349 20:33075519-33075541 TGTCACAGACAGCCCTGCAGTGG + Intergenic
1172227607 20:33315660-33315682 AGGCGAGGAGACCCCTGAAGTGG - Intergenic
1173303650 20:41827597-41827619 TCTCTAGGAGAGCCCTGACATGG + Intergenic
1179234366 21:39531849-39531871 TGGAAAGCAGAGTCCTGAAGAGG + Intergenic
1181473840 22:23156805-23156827 TTTCAAGGAGAGGCCCGAAGAGG - Intronic
1182517132 22:30865235-30865257 GGTCAAGGAGATCCCTGAGTGGG + Intronic
1184240577 22:43209521-43209543 TCTCAAGAGGAGCCCTGACGGGG + Intronic
1184291069 22:43498431-43498453 TGTATAGGGGAGCCCTGGAGGGG + Intronic
1185000427 22:48242166-48242188 TGGAAAGGAGAGCCCAGATGGGG + Intergenic
950427244 3:12931132-12931154 TGCCAAGGGAAGCCCTGCAGGGG - Intronic
950658159 3:14450162-14450184 AGACAAGCAGAGCCCAGAAGAGG - Intronic
951050306 3:18086260-18086282 GGTCAAAGAGAGCCATAAAGAGG - Intronic
951840492 3:27028544-27028566 AGTCAAAGAGAGATCTGAAGAGG + Intergenic
953115624 3:39989755-39989777 GGTCAAGGTCAGGCCTGAAGAGG + Intronic
954156612 3:48688524-48688546 TGGCAAGGAGCGGCCCGAAGTGG - Exonic
954609540 3:51937093-51937115 TGGCAGGCTGAGCCCTGAAGTGG - Intronic
954797275 3:53168051-53168073 GGCCAAGGGGAGCCCTGAGGGGG - Intronic
954876330 3:53805341-53805363 AGTCAAGCATAGCACTGAAGAGG - Intronic
955062222 3:55503157-55503179 GGTCAAGGAAAACCCTGACGTGG + Intergenic
955832120 3:63015627-63015649 GGTCAGGGTGAGGCCTGAAGAGG + Intergenic
956445383 3:69321047-69321069 TTTCAAAGAGGGCCCTGATGCGG + Intronic
956590927 3:70913967-70913989 TGCCAAGGAGAGCATTGAGGTGG - Intergenic
957306267 3:78462192-78462214 TCTCCAGGAGAGCCCTGATTAGG - Intergenic
957584332 3:82114625-82114647 TGTCAGGGTCAGCCCTGAAGAGG + Intergenic
957630076 3:82707148-82707170 TGTCAGGGTCAGTCCTGAAGAGG + Intergenic
957672032 3:83317570-83317592 TGTCTAAGAAAGCCCTGAACAGG + Intergenic
958023519 3:88024772-88024794 TTTCACGGAAAGCCCTGATGGGG + Intergenic
959031087 3:101300147-101300169 TGTCAAGGTCCGGCCTGAAGAGG + Intronic
959561786 3:107790524-107790546 TCTTAAGATGAGCCCTGAAGAGG - Intronic
964364638 3:155936489-155936511 TGGCAATGAGATCCCTGTAGAGG + Exonic
964879312 3:161406075-161406097 TGTCAAGGAGAGGGCTTAGGTGG + Intergenic
965263340 3:166510848-166510870 GGTCAAGGTTAGACCTGAAGAGG - Intergenic
965487169 3:169292606-169292628 TATTAAGGAGGGCCCTGAAAAGG + Intronic
966407605 3:179614272-179614294 TGTCAGGGGGAGACTTGAAGAGG + Intronic
967973825 3:195019696-195019718 GGTGAAGGAGATCCCTGAATTGG - Intergenic
968096023 3:195931399-195931421 TCTCAAGAAAAGCACTGAAGAGG + Intergenic
968885009 4:3324202-3324224 TGTCAAGGGAAGGCCTGACGAGG - Intronic
969600772 4:8174876-8174898 TGGCAATGAGATCCCTGTAGAGG + Intergenic
971007494 4:22391507-22391529 TGTCAGGGAGAACACAGAAGAGG - Intronic
972020878 4:34311792-34311814 TGTCATGAAGATCACTGAAGGGG + Intergenic
975077911 4:70235863-70235885 AGGCAATCAGAGCCCTGAAGAGG + Intergenic
975577262 4:75875676-75875698 TGGCAGAGAGAGCCCTGAAAAGG - Intronic
976681497 4:87761099-87761121 TGTCAACGAGAGGTCAGAAGGGG - Intergenic
979415952 4:120439073-120439095 TCTCTAGGAGAGCCCTGACTAGG - Intergenic
979863882 4:125728733-125728755 TGGGAAGGAGTGCCCTGGAGAGG - Intergenic
979891214 4:126097562-126097584 TGTAAAGGTCAGCCCTCAAGAGG - Intergenic
981906666 4:149929024-149929046 TGCAAAGCAGAGCCATGAAGAGG + Intergenic
982136612 4:152279137-152279159 TGGCAAGGGGAGCCCAGATGCGG - Intergenic
983338776 4:166430758-166430780 ACTCTAGGAGAGCTCTGAAGAGG + Intergenic
984609995 4:181827127-181827149 TGTACAGGAAAGCCCTGAAATGG + Intergenic
984651284 4:182273237-182273259 TGTCAAGCACAGCTCTGAAGAGG + Intronic
985049042 4:185971459-185971481 TCTCTAGGAGATCCCTGATGAGG + Intergenic
985345948 4:189004436-189004458 TGTCACTGAGAGCTCTGATGGGG + Intergenic
986004618 5:3657545-3657567 TGTCAGGGAGAGCCCTGCAGGGG + Intergenic
986492435 5:8306715-8306737 AGTCAAGGTTAGGCCTGAAGAGG - Intergenic
986649344 5:9948257-9948279 CAGCAAGGAGAGGCCTGAAGGGG - Intergenic
988594049 5:32574741-32574763 TGTCTAGGACAGCCTTGAATAGG + Intronic
988642689 5:33058853-33058875 TGACAAGGAGACCCCAGGAGAGG + Intergenic
989076934 5:37573799-37573821 GGTCACTGAGAACCCTGAAGAGG - Intronic
989746149 5:44832512-44832534 TGTCCAGGGGAGCCATGATGGGG - Intergenic
990988305 5:61661279-61661301 TGTCACTGAGAGCCTTCAAGGGG - Intronic
991153368 5:63398836-63398858 TCTCTAGGAGAGCCCTGACTGGG - Intergenic
991156360 5:63440887-63440909 TGTCTAGGAGAGCCCTGACCAGG - Intergenic
991976016 5:72184236-72184258 TGTGCAGGAGAGCTCTGAATGGG - Intronic
995006235 5:107199287-107199309 TTTTCAGGAGAACCCTGAAGTGG - Intergenic
995607039 5:113867909-113867931 CCTCTAGGAGAGCCCTGACGGGG - Intergenic
998600723 5:143582088-143582110 TGTGAAGGAGAGCAGTGAAATGG + Intergenic
998666768 5:144306636-144306658 AGTCAAACAGAGCACTGAAGAGG - Intronic
999327308 5:150651117-150651139 GGAGAAGGAGAGCCCTGTAGGGG + Exonic
1000133304 5:158320546-158320568 TGTGAAGGAGAGAGCAGAAGAGG - Intergenic
1001915484 5:175556880-175556902 TCTCTAGGAGAGCCCTGACTGGG - Intergenic
1003196052 6:3915797-3915819 TGTCTAGGAGAGCCCTAACTAGG - Intergenic
1003227199 6:4217183-4217205 TCTCTAGGAGAGCCCTGACTGGG + Intergenic
1003734647 6:8864865-8864887 TGTCAAGGAAGGCTCTGAGGAGG - Intergenic
1003904278 6:10684667-10684689 TGTAAAGGAGAGGGCTGGAGAGG + Intronic
1004325003 6:14666420-14666442 GCTCTAGGAGAGCCCTGAATGGG - Intergenic
1005703019 6:28422909-28422931 TGTTAAGGAGAACGCTGAGGAGG - Intergenic
1005825396 6:29628800-29628822 TGTCAGGCAGAGCCCAGCAGAGG - Intronic
1008097624 6:47355554-47355576 TGCTAAGGAGAGCCCTCCAGGGG + Intergenic
1008773649 6:55009138-55009160 GGTCAAGGCTAGACCTGAAGAGG + Intergenic
1008834399 6:55808227-55808249 GGTCAAGGTCAGGCCTGAAGAGG + Intronic
1008970471 6:57361527-57361549 TGTCAAGAAGTGGCTTGAAGGGG + Intronic
1009159440 6:60263348-60263370 TGTCAAGAAGTGGCTTGAAGGGG + Intergenic
1010090386 6:71973630-71973652 TGTCCAGGAGAGCCCTGGCTAGG + Intronic
1010945625 6:81970300-81970322 AGTCAGGTAGAGGCCTGAAGAGG - Intergenic
1011526314 6:88269021-88269043 GGTCAAGGAAAGAACTGAAGTGG + Intergenic
1012375219 6:98554120-98554142 TGTCAAGGACAGCACAGGAGAGG + Intergenic
1015123619 6:129728197-129728219 AGTCAAGGAGATCCCTGAAATGG + Intergenic
1016846321 6:148571623-148571645 TCTCTAGGAGAGCCCTGAGCAGG + Intergenic
1017622282 6:156311180-156311202 TATGAAGGAGAACCCAGAAGAGG + Intergenic
1018847764 6:167567090-167567112 TGTCCATGAGAGCCCTGCTGGGG - Intergenic
1020404556 7:7817263-7817285 TGACCAGGAGTGCCATGAAGTGG + Intronic
1020633784 7:10672146-10672168 TGTCAGGGTTAGGCCTGAAGAGG + Intergenic
1023207189 7:37763659-37763681 GGTCAAGGTCAGGCCTGAAGAGG - Intronic
1023913345 7:44570508-44570530 TGGCATGCAGAGCCCTGCAGGGG - Intronic
1024044545 7:45577880-45577902 TATCAAGGATAGCCCTAAGGAGG + Intronic
1024148087 7:46537319-46537341 TGTGAAGGAGATCTCTGCAGGGG + Intergenic
1027753412 7:82180622-82180644 TCTCTAGGAGAGCCCTGATGAGG + Intronic
1029012026 7:97272346-97272368 TTTCTAGGAGAGCCCTGACTAGG + Intergenic
1033216203 7:139495438-139495460 TGTGAATGAGATCCCTGGAGTGG - Intergenic
1033552984 7:142464507-142464529 TGTCAAAAAGAGCTCTAAAGTGG + Intergenic
1034333988 7:150308647-150308669 TGTCAAGGAGTGGCCTGGGGAGG - Intronic
1035345597 7:158195299-158195321 TCTCAAGGAGAAACCTGCAGTGG + Intronic
1035491697 7:159284918-159284940 TGTCAGGGTCAGGCCTGAAGAGG - Intergenic
1035642856 8:1197215-1197237 TTTCCAGAAGAGACCTGAAGTGG - Intergenic
1037800732 8:22033882-22033904 GGTCTAGGAAAGCCCTGCAGAGG - Intronic
1040614187 8:49018297-49018319 GGTCAAGGTTAGGCCTGAAGAGG + Intergenic
1040762993 8:50873823-50873845 GGTCAAGGTCAGGCCTGAAGAGG + Intergenic
1040934287 8:52766836-52766858 TCTCCAGGAGAGCCCTGACCAGG - Intergenic
1040959775 8:53019310-53019332 TGTCAGGGTCAGGCCTGAAGAGG - Intergenic
1043826057 8:84929665-84929687 TGTCTAGGAGAGCCCTGACCAGG - Intergenic
1044624905 8:94227465-94227487 TCCCAAGGGGAGCCCTGGAGTGG - Intergenic
1046155830 8:110289132-110289154 TCTCTTGGAGTGCCCTGAAGGGG - Intergenic
1047661214 8:127038986-127039008 TATCAAGGAAAGCCTTGAAGTGG - Intergenic
1049567458 8:143348509-143348531 TGTAAAGGGGTGCCCTGCAGGGG + Intronic
1050039639 9:1475714-1475736 TTTCTAGGAGAGCCCTGATGGGG - Intergenic
1050109420 9:2199668-2199690 TTTCAAGGAGAACCCTGGTGAGG - Intergenic
1050488841 9:6165712-6165734 TGGCTAGGAGACACCTGAAGAGG - Intergenic
1050660747 9:7880264-7880286 GGTCAAGGTCAGGCCTGAAGAGG - Intronic
1050701618 9:8346099-8346121 TGTCAAGGAGAGCCTGAGAGTGG - Intronic
1052242410 9:26290309-26290331 TGTTAAGGAGAGACCAGAATCGG + Intergenic
1052775506 9:32728733-32728755 TCTCTAGGAGAGCCCTGAGTAGG - Intergenic
1055317354 9:75047451-75047473 TATCAAGGGAAGCCTTGAAGAGG + Intergenic
1056926290 9:90837574-90837596 GGTCAAGGAGAGCCTTGTGGAGG + Intronic
1057494557 9:95550707-95550729 AGACAAGAAGAGCCTTGAAGAGG + Intergenic
1057639461 9:96803520-96803542 TCTCTAGGAGAGCCCTGACCAGG + Intergenic
1057888935 9:98853299-98853321 TCTCCAGGAGAGCCCTGACGGGG + Intergenic
1060311124 9:122463777-122463799 TGTGGCGGAGAGACCTGAAGAGG - Intergenic
1061674508 9:132208191-132208213 TTTGAAGGAGAAACCTGAAGGGG + Intronic
1061809847 9:133155873-133155895 TGTCATGGAGAGGCCTGATGGGG - Intronic
1062013105 9:134277411-134277433 TGCCTAGGAGAGCCCAGCAGAGG - Intergenic
1185952489 X:4452038-4452060 TGTCAGGGTCAGGCCTGAAGAGG - Intergenic
1187280053 X:17851514-17851536 TGTCAAGGAAAGCACAGAATAGG - Intronic
1188092167 X:25977154-25977176 TGTCAGGGTCAGTCCTGAAGAGG - Intergenic
1189561338 X:42194343-42194365 TGTCAAGCAAAGCCCAGAAAGGG - Intergenic
1190155983 X:47992794-47992816 TCTCTAGGAGAGCCCTGACTGGG - Intronic
1195215617 X:102698528-102698550 TTGCAAGGAGAGCCCTGACCAGG - Intergenic
1197043430 X:121968340-121968362 TGTGAAGGATAGACCTGATGAGG + Intergenic
1197751416 X:129966410-129966432 CATCAAGGCGAGCCTTGAAGGGG - Intergenic
1199606597 X:149584041-149584063 TCTCCAGGAGACACCTGAAGAGG + Intronic
1199632526 X:149785327-149785349 TCTCCAGGAGACACCTGAAGAGG - Intronic
1200307751 X:155045707-155045729 TGTAAAGGAGAGCACAGAAAAGG + Intronic
1202092533 Y:21208927-21208949 TGTCAGGGTCAGGCCTGAAGAGG - Intergenic