ID: 1076116916

View in Genome Browser
Species Human (GRCh38)
Location 10:127907303-127907325
Sequence CCCCGAGGTGAGCGCGCGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076116907_1076116916 12 Left 1076116907 10:127907268-127907290 CCGCTGCAGCGCGATCTGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1076116916 10:127907303-127907325 CCCCGAGGTGAGCGCGCGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 69
1076116905_1076116916 30 Left 1076116905 10:127907250-127907272 CCGGGAGATGCGGAGCCTCCGCT 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1076116916 10:127907303-127907325 CCCCGAGGTGAGCGCGCGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 69
1076116906_1076116916 15 Left 1076116906 10:127907265-127907287 CCTCCGCTGCAGCGCGATCTGCG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1076116916 10:127907303-127907325 CCCCGAGGTGAGCGCGCGTGCGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076116916 Original CRISPR CCCCGAGGTGAGCGCGCGTG CGG Exonic