ID: 1076117005 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:127907558-127907580 |
Sequence | GAGCGTGAGCACTGCCACTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 7 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076117005_1076117010 | -1 | Left | 1076117005 | 10:127907558-127907580 | CCACAGTGGCAGTGCTCACGCTC | No data | ||
Right | 1076117010 | 10:127907580-127907602 | CCCTCTCGGTAAACAGGAGGAGG | No data | ||||
1076117005_1076117007 | -7 | Left | 1076117005 | 10:127907558-127907580 | CCACAGTGGCAGTGCTCACGCTC | No data | ||
Right | 1076117007 | 10:127907574-127907596 | CACGCTCCCTCTCGGTAAACAGG | No data | ||||
1076117005_1076117008 | -4 | Left | 1076117005 | 10:127907558-127907580 | CCACAGTGGCAGTGCTCACGCTC | No data | ||
Right | 1076117008 | 10:127907577-127907599 | GCTCCCTCTCGGTAAACAGGAGG | No data | ||||
1076117005_1076117015 | 19 | Left | 1076117005 | 10:127907558-127907580 | CCACAGTGGCAGTGCTCACGCTC | No data | ||
Right | 1076117015 | 10:127907600-127907622 | AGGGCGCGCGTGTCTGCGGGTGG | No data | ||||
1076117005_1076117013 | 15 | Left | 1076117005 | 10:127907558-127907580 | CCACAGTGGCAGTGCTCACGCTC | No data | ||
Right | 1076117013 | 10:127907596-127907618 | GAGGAGGGCGCGCGTGTCTGCGG | No data | ||||
1076117005_1076117012 | 0 | Left | 1076117005 | 10:127907558-127907580 | CCACAGTGGCAGTGCTCACGCTC | No data | ||
Right | 1076117012 | 10:127907581-127907603 | CCTCTCGGTAAACAGGAGGAGGG | No data | ||||
1076117005_1076117014 | 16 | Left | 1076117005 | 10:127907558-127907580 | CCACAGTGGCAGTGCTCACGCTC | No data | ||
Right | 1076117014 | 10:127907597-127907619 | AGGAGGGCGCGCGTGTCTGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076117005 | Original CRISPR | GAGCGTGAGCACTGCCACTG TGG (reversed) | Intronic | ||