ID: 1076117005

View in Genome Browser
Species Human (GRCh38)
Location 10:127907558-127907580
Sequence GAGCGTGAGCACTGCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076117005_1076117010 -1 Left 1076117005 10:127907558-127907580 CCACAGTGGCAGTGCTCACGCTC No data
Right 1076117010 10:127907580-127907602 CCCTCTCGGTAAACAGGAGGAGG No data
1076117005_1076117007 -7 Left 1076117005 10:127907558-127907580 CCACAGTGGCAGTGCTCACGCTC No data
Right 1076117007 10:127907574-127907596 CACGCTCCCTCTCGGTAAACAGG No data
1076117005_1076117008 -4 Left 1076117005 10:127907558-127907580 CCACAGTGGCAGTGCTCACGCTC No data
Right 1076117008 10:127907577-127907599 GCTCCCTCTCGGTAAACAGGAGG No data
1076117005_1076117015 19 Left 1076117005 10:127907558-127907580 CCACAGTGGCAGTGCTCACGCTC No data
Right 1076117015 10:127907600-127907622 AGGGCGCGCGTGTCTGCGGGTGG No data
1076117005_1076117013 15 Left 1076117005 10:127907558-127907580 CCACAGTGGCAGTGCTCACGCTC No data
Right 1076117013 10:127907596-127907618 GAGGAGGGCGCGCGTGTCTGCGG No data
1076117005_1076117012 0 Left 1076117005 10:127907558-127907580 CCACAGTGGCAGTGCTCACGCTC No data
Right 1076117012 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
1076117005_1076117014 16 Left 1076117005 10:127907558-127907580 CCACAGTGGCAGTGCTCACGCTC No data
Right 1076117014 10:127907597-127907619 AGGAGGGCGCGCGTGTCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076117005 Original CRISPR GAGCGTGAGCACTGCCACTG TGG (reversed) Intronic