ID: 1076117011

View in Genome Browser
Species Human (GRCh38)
Location 10:127907581-127907603
Sequence CCCTCCTCCTGTTTACCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076117011_1076117016 9 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117016 10:127907613-127907635 CTGCGGGTGGCTACAGTGCGCGG No data
1076117011_1076117021 19 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117021 10:127907623-127907645 CTACAGTGCGCGGGGGCCGGCGG No data
1076117011_1076117023 24 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117023 10:127907628-127907650 GTGCGCGGGGGCCGGCGGCAGGG No data
1076117011_1076117013 -8 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117013 10:127907596-127907618 GAGGAGGGCGCGCGTGTCTGCGG No data
1076117011_1076117024 27 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117024 10:127907631-127907653 CGCGGGGGCCGGCGGCAGGGCGG No data
1076117011_1076117017 10 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117017 10:127907614-127907636 TGCGGGTGGCTACAGTGCGCGGG No data
1076117011_1076117019 12 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117019 10:127907616-127907638 CGGGTGGCTACAGTGCGCGGGGG No data
1076117011_1076117018 11 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117018 10:127907615-127907637 GCGGGTGGCTACAGTGCGCGGGG No data
1076117011_1076117020 16 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117020 10:127907620-127907642 TGGCTACAGTGCGCGGGGGCCGG No data
1076117011_1076117022 23 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117022 10:127907627-127907649 AGTGCGCGGGGGCCGGCGGCAGG No data
1076117011_1076117014 -7 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117014 10:127907597-127907619 AGGAGGGCGCGCGTGTCTGCGGG No data
1076117011_1076117015 -4 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117015 10:127907600-127907622 AGGGCGCGCGTGTCTGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076117011 Original CRISPR CCCTCCTCCTGTTTACCGAG AGG (reversed) Intronic