ID: 1076117015

View in Genome Browser
Species Human (GRCh38)
Location 10:127907600-127907622
Sequence AGGGCGCGCGTGTCTGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076117009_1076117015 -3 Left 1076117009 10:127907580-127907602 CCCTCTCGGTAAACAGGAGGAGG No data
Right 1076117015 10:127907600-127907622 AGGGCGCGCGTGTCTGCGGGTGG No data
1076117005_1076117015 19 Left 1076117005 10:127907558-127907580 CCACAGTGGCAGTGCTCACGCTC No data
Right 1076117015 10:127907600-127907622 AGGGCGCGCGTGTCTGCGGGTGG No data
1076117011_1076117015 -4 Left 1076117011 10:127907581-127907603 CCTCTCGGTAAACAGGAGGAGGG No data
Right 1076117015 10:127907600-127907622 AGGGCGCGCGTGTCTGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076117015 Original CRISPR AGGGCGCGCGTGTCTGCGGG TGG Intronic