ID: 1076120941

View in Genome Browser
Species Human (GRCh38)
Location 10:127935938-127935960
Sequence AGGTGAGAGCAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1733
Summary {0: 1, 1: 1, 2: 18, 3: 170, 4: 1543}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076120941_1076120946 0 Left 1076120941 10:127935938-127935960 CCTTCTTCCCTCTGCTCTCACCT 0: 1
1: 1
2: 18
3: 170
4: 1543
Right 1076120946 10:127935961-127935983 CAGGTGCCTTCCTAATGTGCAGG No data
1076120941_1076120949 23 Left 1076120941 10:127935938-127935960 CCTTCTTCCCTCTGCTCTCACCT 0: 1
1: 1
2: 18
3: 170
4: 1543
Right 1076120949 10:127935984-127936006 TGACGATTGCCTCTGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076120941 Original CRISPR AGGTGAGAGCAGAGGGAAGA AGG (reversed) Intronic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900522295 1:3111522-3111544 AGGGGAGAGCGGAGGGAAAGAGG + Intronic
900546257 1:3230896-3230918 AGGTGTGAGCAAAGGGAGCAGGG + Intronic
900608742 1:3535590-3535612 ATGTGAGGGCAGAGGGGAGGTGG - Intronic
900742780 1:4340748-4340770 AGGTGGGACCTGGGGGAAGACGG + Intergenic
901216776 1:7559499-7559521 ATCAGAGAGCAGAGGGAAGCGGG + Intronic
901241301 1:7695297-7695319 AGCTCTGAGCAGAGAGAAGAGGG + Intronic
901866263 1:12109051-12109073 AGGTGAGAGATGGGGCAAGATGG - Intronic
902376029 1:16030283-16030305 TGGTGAGAGGAGAGGGATAAGGG - Intronic
902380968 1:16052028-16052050 TGGTGAGAGGAGAGGGATAAGGG - Intronic
902450128 1:16491426-16491448 AGGAGAGAGAAGAGGGAATGGGG + Intergenic
902482163 1:16717744-16717766 GGGTGAGTGCTGAGGGAGGAAGG - Intergenic
902502713 1:16921728-16921750 AGGAGGGAGGAGAGAGAAGAGGG - Intronic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
902667028 1:17946680-17946702 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
902864764 1:19270664-19270686 TGGTGAGAGCAGAGGCACCAGGG - Intergenic
902866983 1:19286101-19286123 TGGTGAGAGCAGAGGCACCAGGG - Intronic
903038860 1:20513363-20513385 AGGAAAGAGAAGAGGGAGGAAGG + Intergenic
903304275 1:22401601-22401623 TGGTAAGACCAGAGGAAAGAAGG - Intergenic
903517529 1:23921909-23921931 AGGTTAAAGCAGAGGGAACATGG - Intergenic
903652682 1:24930957-24930979 AGGGGAGAGCAGAGAGGAAAGGG - Intronic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
903850119 1:26300905-26300927 AGGTGAGAGCAGAGGCCTGAAGG - Exonic
904653054 1:32020792-32020814 TGGTGAGAGATGAGGGAAAACGG + Intronic
904706497 1:32394751-32394773 AGCTGGGAGCAGAGGGGAGGAGG + Intergenic
905005735 1:34708814-34708836 TGGGGAGAGCAGATAGAAGAGGG + Intergenic
905037124 1:34925518-34925540 AGGGGAGGGGAGAGGGGAGAGGG + Intronic
905673290 1:39807606-39807628 GGGAGAGGGCAGAGGGGAGAGGG - Intergenic
905787480 1:40769891-40769913 AGGGGAAAGCAGAGGGAAAAGGG - Intronic
905968036 1:42115944-42115966 TAGTCAGAGCAGAGGGAACAAGG + Intergenic
906283662 1:44571198-44571220 TAGAGAGAGCAGATGGAAGAGGG - Intronic
906293623 1:44635784-44635806 AGGAGAGAGCAGTGGTCAGAAGG - Intronic
906452746 1:45965790-45965812 AGGTGAGGGCAGGGGGTATATGG - Intronic
906576736 1:46898031-46898053 AGGTGAGAGCAGAGCATAAAGGG + Intergenic
906595183 1:47069554-47069576 AGGTGAGAGCAGAGCATAAAGGG - Intronic
906748158 1:48235914-48235936 AGGGCAGGGCAGAGGGGAGAGGG - Intronic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
907208384 1:52795502-52795524 AGGCCAGAGCAGAGAGAACAAGG - Intronic
907289897 1:53407066-53407088 AGGAGAGGGCCGAGGGAAGCTGG + Intergenic
907303704 1:53502727-53502749 GGGAGAGAGGAGAGGGAAGGGGG + Intergenic
907303712 1:53502752-53502774 GGGAGAGAGGAGAGGGGAGAGGG + Intergenic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
907485491 1:54775054-54775076 GGGTGAGGGCAGAGGGAATGTGG + Intergenic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
907575865 1:55525046-55525068 AGGTGAGGGCAGCAAGAAGATGG - Intergenic
907775400 1:57509511-57509533 AGGTGAGAGGAAAATGAAGAAGG - Intronic
907878379 1:58518196-58518218 AGGAGAGGGGAGAGGGGAGAGGG + Intronic
908459011 1:64331107-64331129 AGGTGAGAGCTTAGAGAAGCAGG - Intergenic
908742952 1:67347652-67347674 AGGTCAGAGCAGAAAGAAAATGG + Intronic
908768125 1:67572400-67572422 ACAGGAGAGCAGAGGGAAGGAGG + Intergenic
909044913 1:70698390-70698412 AGGTGAGAAGAGAGAGAAGCTGG - Intergenic
909840042 1:80309171-80309193 AAGTGAGAGCTGAGTGAAGGGGG - Intergenic
909976457 1:82051310-82051332 AGGTTAGAGAAGCAGGAAGATGG - Intergenic
910098465 1:83551160-83551182 AGGAGAGAGCATTGGGAAGGAGG + Intergenic
910259152 1:85279157-85279179 AGGGGAAAGAAGATGGAAGAGGG + Intergenic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
910986880 1:93013914-93013936 AGTTCAGGCCAGAGGGAAGATGG - Intergenic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911301784 1:96183488-96183510 GGGGGAGGGCAGGGGGAAGAAGG + Intergenic
911315730 1:96354586-96354608 AGGTAGGAGTAGAGGGAGGATGG - Intergenic
911332536 1:96541869-96541891 TGGTGAGAGCACAGGGTGGAGGG - Intergenic
911557012 1:99356786-99356808 AGGTGAGAGGAGAGAGAGGTGGG - Intergenic
912011265 1:104966550-104966572 AGGGAAGGGAAGAGGGAAGAGGG - Intergenic
912412533 1:109488629-109488651 AGGTGGGAACAGTGGGAAGGAGG + Intronic
912802406 1:112728391-112728413 AGGAGAGGGAAGAGGGAAGAGGG - Intergenic
913057465 1:115175614-115175636 GGGTGAGATGAAAGGGAAGAAGG + Intergenic
913223133 1:116675415-116675437 ATCTGAGAGAAGAGGGAAGAAGG + Intergenic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
913466650 1:119149867-119149889 AGGTGAGAGTAAAGAGAATAAGG + Intergenic
913685733 1:121230276-121230298 AGGTGAGAGATGATGGCAGATGG - Intronic
913966550 1:143381749-143381771 AGCACAGAGCAGAGGGCAGAGGG + Intergenic
914037581 1:144017879-144017901 AGGTGAGAGATGATGGCAGATGG - Intergenic
914060925 1:144207356-144207378 AGCACAGAGCAGAGGGCAGAGGG + Intergenic
914118225 1:144759013-144759035 AGCACAGAGCAGAGGGCAGAGGG - Intergenic
914151873 1:145050053-145050075 AGGTGAGAGATGATGGCAGATGG + Intronic
914334478 1:146701978-146702000 AGGGCAGAGCCGAGGGATGATGG - Intergenic
914346998 1:146808482-146808504 AGGAGAGGGCAGAAGGATGAGGG + Intergenic
914513100 1:148351896-148351918 AGGAGAAAGCAGGTGGAAGAGGG + Intergenic
914666333 1:149835856-149835878 AGGAGAGGGCAGAGGCAAGGAGG + Intergenic
914669434 1:149857942-149857964 AGGAGAGGGCAGAGGCAAGGAGG - Intronic
914684677 1:149967859-149967881 TGGTGGGAGGAGAGGGAATAAGG + Intronic
914799787 1:150952367-150952389 AGGTGATAGTAGAGGTAAGAAGG + Intronic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915243661 1:154541538-154541560 AGGTGAGAACAGTGGAGAGAGGG + Intronic
915446844 1:155978841-155978863 AGGGGAGGGCAGAGGGGAAAGGG - Intronic
915580836 1:156812351-156812373 AGATGAGATCAGAGGGGTGAGGG - Intronic
915588916 1:156859838-156859860 TGGGGAGAGCGAAGGGAAGAGGG - Intronic
915734929 1:158078606-158078628 AGGAGGCAGCTGAGGGAAGAAGG - Intronic
915811861 1:158921296-158921318 AAATGAGAGCTGAGGGAAGAAGG - Intergenic
915837346 1:159188311-159188333 GGGCGAGAGGAGAGGGGAGAGGG - Intronic
916188351 1:162154689-162154711 AGGTCACAAGAGAGGGAAGATGG - Intronic
916188769 1:162158885-162158907 AAGTGAGAGAAGAGGGAATATGG + Intronic
916473446 1:165145970-165145992 AGGAGAGAAGAAAGGGAAGAAGG - Intergenic
916720441 1:167481461-167481483 AGTTGGGAGCAGAGGGAGGATGG + Intronic
916961951 1:169897349-169897371 AGGTGAGGACACTGGGAAGAGGG - Intergenic
917449625 1:175136324-175136346 AGAGGAGAGCAGAGGGAAAAGGG - Intronic
917793071 1:178512288-178512310 AGTTGAAATGAGAGGGAAGAAGG + Intergenic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
918339470 1:183556189-183556211 AGGGGAGTGCAAAGGGAAGGTGG - Exonic
918991395 1:191701187-191701209 AGGGCAAAGGAGAGGGAAGAGGG - Intergenic
919102247 1:193109008-193109030 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
919257448 1:195142354-195142376 AGAGGAGAGCAGAGGGGAGGAGG - Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
919469242 1:197958247-197958269 AGGTGAGAGGAGATGGAATGTGG + Intergenic
919619007 1:199843781-199843803 AGGAAAGAACAGAGGGAGGAAGG - Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919795423 1:201318794-201318816 AGGTGAGAGAAGAGGATACATGG + Exonic
919825816 1:201502398-201502420 AGCTGAGGGCAGAGAGAGGAGGG + Intronic
919873374 1:201841893-201841915 GTGTGAGAGCAGAGGAAAAATGG - Intronic
919907574 1:202088437-202088459 AGATGAGGGCAGAGGTAAGCAGG + Intergenic
919991581 1:202711024-202711046 AGGAGAGAGGAGCTGGAAGACGG + Intergenic
920042663 1:203112961-203112983 AGGGGAGAGATGGGGGAAGAGGG - Intronic
920430727 1:205917236-205917258 GGGTGGGAGCAGGGCGAAGAGGG - Intronic
920473054 1:206248833-206248855 AGGTGAGAGATGATGGCAGATGG - Intronic
920539395 1:206766785-206766807 AGCTGAGATCAGAGGCAACAGGG - Intergenic
921087629 1:211810947-211810969 AGGTGACAACAGAGGGAAGTAGG + Intronic
921230736 1:213067646-213067668 AGGGGAGTGCAGAGTGAAGGAGG - Intronic
921292037 1:213667208-213667230 AAGTTACAGCAGAGGGAAAATGG + Intergenic
921683278 1:218059876-218059898 AGCTGGGGGCAGAGGGAAGGAGG - Intergenic
921730829 1:218576239-218576261 TGGTGAGGGCATGGGGAAGAGGG + Intergenic
921813872 1:219544972-219544994 AGGAGAGGGGAGAGGGGAGAGGG - Intergenic
921813875 1:219544979-219545001 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
921837625 1:219794418-219794440 AGGAGAGATGTGAGGGAAGAAGG + Intronic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922292360 1:224218999-224219021 AGCTGAAAGCAGATGGAGGAGGG + Intergenic
922479386 1:225928449-225928471 AGGGGAGTGAAGAGGGAGGAAGG - Intergenic
922716996 1:227882955-227882977 AGGGCAGAGAAGAGGGGAGAAGG + Intergenic
922739573 1:228007548-228007570 AGGGGACAGGCGAGGGAAGAGGG + Intronic
922896233 1:229102647-229102669 AGGTGAGCGGGGAGGGGAGAAGG - Intergenic
923146529 1:231202439-231202461 AGGTGAGAGCAGAATGAGCAAGG + Intronic
923274459 1:232384467-232384489 AGGAGAGAGAAGAAGGGAGAGGG - Intergenic
923482427 1:234397416-234397438 AGGGGGGAGGAGGGGGAAGAGGG + Intronic
923482436 1:234397435-234397457 AGGGGGGAGGAGGGGGAAGATGG + Intronic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
924395784 1:243619178-243619200 AGGTGGGAGAAACGGGAAGAGGG + Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063082593 10:2782665-2782687 AGGTAGGAGGAGAGGGGAGACGG - Intergenic
1063082603 10:2782710-2782732 AGATGGGAGGAGAGGGGAGATGG - Intergenic
1063091677 10:2871026-2871048 AGTGGGGGGCAGAGGGAAGAAGG - Intergenic
1063215438 10:3921495-3921517 AGGTGAGAGGAAAAGAAAGAGGG - Intergenic
1063309012 10:4935503-4935525 TGCTGACAGCTGAGGGAAGAGGG + Intronic
1063427088 10:5958954-5958976 AGGGGAGAACAGGAGGAAGAAGG - Intronic
1063480143 10:6368271-6368293 AGGAGAGAGTAAAGGGAACAGGG + Intergenic
1063967721 10:11359798-11359820 AGGGGAGAGGAGGGAGAAGAAGG + Intergenic
1064068237 10:12202364-12202386 GTGTGAGAGCAGAGGAAAAACGG - Intronic
1064146105 10:12827637-12827659 AGGAGAGAGGAGAGGGGAGAGGG - Intronic
1064146113 10:12827665-12827687 AGGAGAAAGGAGAGGGGAGAAGG - Intronic
1064225262 10:13478067-13478089 AGGGGAGAGGGGAGGGAGGATGG + Intronic
1064322867 10:14321957-14321979 TGGTGGGAGCAGGAGGAAGAGGG - Intronic
1064453697 10:15467222-15467244 AGGGGAGAGAAGAGGGATGGAGG + Intergenic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1064528587 10:16283907-16283929 AGGTGAGAGATAAGGGAAGAGGG + Intergenic
1064549187 10:16481413-16481435 AGCTGAATGCAGAGGGAAAAGGG + Intronic
1064714293 10:18160749-18160771 AAGTGACAGAATAGGGAAGAGGG - Intronic
1064859944 10:19816136-19816158 AGGGGAGGGCGGAGGGAGGAGGG + Intergenic
1065202928 10:23331297-23331319 AGGGAAGGGAAGAGGGAAGAGGG + Intronic
1065204046 10:23341653-23341675 AGGTGAAGTCAGAGGGAAGGGGG - Intronic
1065363588 10:24912805-24912827 AGGTGAGAGCTGATGGATCACGG - Intronic
1066094884 10:32062627-32062649 AGGTGGGACCTGAGGAAAGACGG - Intergenic
1067044875 10:42979918-42979940 AGGGGACAGGAGTGGGAAGAGGG + Intergenic
1067176298 10:43950362-43950384 AGAGGAGAGAAAAGGGAAGAGGG - Intergenic
1067747707 10:48948782-48948804 AGCTGATTGCAGAGGGAAGAAGG - Intronic
1067777043 10:49171350-49171372 AGCAGAGAGCAGAGGGCAGAGGG + Intronic
1067911935 10:50355274-50355296 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1068189731 10:53635545-53635567 AGGTGAGAGAGCAGGGAACAAGG + Intergenic
1068868944 10:61923241-61923263 AGTTAAGAGGTGAGGGAAGATGG - Intronic
1069152336 10:64979330-64979352 AGGAGAAAACGGAGGGAAGAAGG - Intergenic
1069531891 10:69225801-69225823 AGGTGAGAGGTGAGGTGAGAGGG - Intronic
1069950682 10:72016180-72016202 AGGGAAGAGAAGAGGAAAGAAGG + Intergenic
1070487558 10:76945038-76945060 AAGTGAGAGGAGAGGGAAAGAGG + Intronic
1070648133 10:78215631-78215653 AGGTGGGAGGAAAGGGGAGAGGG + Intergenic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1070998236 10:80805592-80805614 AGGTGAGAAAAGAGAGAAGGAGG - Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071719709 10:88131113-88131135 AGGTGAGAGCTGAGGGGATGTGG + Intergenic
1071940890 10:90590245-90590267 AGGTCAGAGTCGAGGGAAGAGGG - Intergenic
1072454978 10:95567636-95567658 AGGGGAGAGGAGAGGGGAGGGGG + Intergenic
1072695304 10:97599048-97599070 AGGTGAGAGCAGGCAGAAGGAGG - Intronic
1073115377 10:101088775-101088797 AGGTGGGAGGAGAGAGAAGGAGG - Intergenic
1073483397 10:103801149-103801171 AGGTGGGAGCAGAGGGACAGAGG - Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073649021 10:105339269-105339291 AGAGCAGAGAAGAGGGAAGAGGG - Intergenic
1073676651 10:105654952-105654974 TGGTGGGAGCAGAAGCAAGAGGG - Intergenic
1074554418 10:114475151-114475173 AGGTGAGAGACGAGGTAGGAGGG - Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1075021642 10:118956674-118956696 AGGTGAGTGCACAGGTGAGATGG + Intergenic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075546501 10:123358941-123358963 AGCTGAGACCATAGGGAACAGGG - Intergenic
1075575155 10:123572609-123572631 AGGGGAGAGGAGAGGAGAGAGGG + Intergenic
1075575174 10:123572679-123572701 AGGGGAGAGGAGAGGAGAGAGGG + Intergenic
1075575179 10:123572698-123572720 AGGGGAGAGGAGAGGAGAGAGGG + Intergenic
1075873151 10:125785854-125785876 ACGTGAGAGCAGATGCAAAAAGG + Intronic
1075984279 10:126770189-126770211 AGATGTGGGGAGAGGGAAGATGG - Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076130472 10:128010489-128010511 AGTTGAGAGGAGAAGGAAGTAGG - Intronic
1076273387 10:129175877-129175899 AGGTGAGATCATAATGAAGAAGG - Intergenic
1076347980 10:129793800-129793822 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
1076628960 10:131841436-131841458 AGGTGACAGCAGAGGGGAGGGGG - Intergenic
1076642927 10:131931108-131931130 AGGGGAGAGGAGAGGGATGCTGG - Intronic
1076811187 10:132887302-132887324 AGGAGAGAGGGGAGAGAAGAGGG - Intronic
1076811212 10:132887441-132887463 AGGGGAGAGGAGAGAGAAGAGGG - Intronic
1076811234 10:132887554-132887576 AGAGGAGAGGAGAGAGAAGAAGG - Intronic
1076811248 10:132887634-132887656 AGAGGAGAGGAGAGAGAAGAAGG - Intronic
1076811269 10:132887771-132887793 AGAGGAGAGGAGAGAGAAGAAGG - Intronic
1076811281 10:132887829-132887851 AGAGGAGAGGAGAGAGAAGAAGG - Intronic
1076811289 10:132887868-132887890 AGAGGAGAGGAGAGAGAAGAAGG - Intronic
1076811295 10:132887909-132887931 AGAGGAGAGGAGAGAGAAGAAGG - Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077136710 11:1003213-1003235 AGGAGAGGCCAGAGGGGAGATGG + Intronic
1077239297 11:1502313-1502335 AGGTGCCACCAGAGGGAGGAAGG + Intergenic
1077484261 11:2831696-2831718 AGGGGAGGGCAGCGGGGAGAAGG - Intronic
1077604195 11:3596478-3596500 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1077654750 11:4007829-4007851 TGGTGAGAGCTGTGGGAAAATGG + Intronic
1077809964 11:5627065-5627087 AGATGAGAGCAGAGTGAAGAAGG + Intronic
1077867503 11:6234958-6234980 AGGTGGAACCAGAGGGCAGAAGG + Intronic
1077914076 11:6599778-6599800 AGATGACAGCAGAGTGGAGATGG + Exonic
1078164494 11:8870863-8870885 AGTCGGGAGCAGAGGGAAAAGGG + Intronic
1078334011 11:10450191-10450213 AGGTGAAGGCAGAGCGAGGAGGG + Intronic
1078361306 11:10669951-10669973 AAAAGAGAGCAGAGGAAAGAGGG + Intronic
1078421874 11:11219319-11219341 GGGTGAGAGGAGAGAGGAGACGG - Intergenic
1078578290 11:12519303-12519325 AGCTCAGAGCAGAGGCAGGAAGG - Intronic
1079110531 11:17602720-17602742 AGGGAAGAGAGGAGGGAAGAAGG - Intronic
1079117005 11:17646279-17646301 GGGTGAGAGCTGTGGGAAGATGG + Intronic
1079427799 11:20360194-20360216 AGGGGAAAGCATAGGGAAGGAGG - Intergenic
1079545180 11:21625428-21625450 AGCTGAGAGAAGAGGGAGGTAGG - Intergenic
1079617213 11:22510511-22510533 TGCTGAGCGGAGAGGGAAGAGGG - Intergenic
1080127527 11:28754454-28754476 AGGGAGGAACAGAGGGAAGAAGG + Intergenic
1080176001 11:29363910-29363932 AGGAGAGAGAAGAGGGAGTAGGG + Intergenic
1080430593 11:32195345-32195367 AGGAGAGAGCAAAGTGAGGAAGG + Intergenic
1080599276 11:33806871-33806893 AGGTGAGAGCTGAGGGATGCTGG + Intergenic
1080739693 11:35052278-35052300 AGGTGACAGCCATGGGAAGAGGG + Intergenic
1080883546 11:36345091-36345113 GGGTGAGAGCAGCGGCAGGAAGG + Intronic
1080985406 11:37457940-37457962 ACCTGAGAGTAGAAGGAAGATGG - Intergenic
1081489490 11:43556554-43556576 AGGTGAGGGTAGAGGGAGGGAGG - Intronic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082286377 11:50322270-50322292 AGGTGAGAGACGATGGCAGATGG - Intergenic
1082568196 11:54706836-54706858 AGGTGAGAGCTCAGGGAAACAGG - Intergenic
1082849574 11:57753286-57753308 ACTTGAGGGCTGAGGGAAGATGG + Intronic
1083028378 11:59570092-59570114 AATGGAGGGCAGAGGGAAGAAGG - Intergenic
1083096984 11:60260989-60261011 AGGTGAGAAGAGAGAGACGAGGG - Intergenic
1083250543 11:61464008-61464030 AGGAGAGAGGAGAGGGAAGAGGG - Intronic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083421229 11:62554403-62554425 AGTTCAGGGCTGAGGGAAGAAGG - Intronic
1083439412 11:62665953-62665975 AGGTGGGGGCAGAGTGGAGAGGG + Intronic
1083484666 11:62975860-62975882 AGGGAAGAGAAGAGGGAAGGGGG - Intronic
1083654712 11:64224029-64224051 AGGAGAGAGGTGAGGGCAGAAGG + Intronic
1083860739 11:65418672-65418694 AGGAGGCAGGAGAGGGAAGAAGG - Intergenic
1084157229 11:67320625-67320647 AGCTGAGAGCCCAGGGAACAAGG + Intronic
1084192124 11:67504082-67504104 AGGTGAGGGCGGCGGGGAGAGGG - Exonic
1084226645 11:67719290-67719312 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084260093 11:67971072-67971094 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084267731 11:68013476-68013498 AGGTGAGAGTAGAATGGAGAAGG + Intronic
1084406779 11:68978935-68978957 AGGTGAGGGAGGAGGAAAGACGG - Intergenic
1084812679 11:71624182-71624204 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1084934942 11:72581819-72581841 ATGTGACAGTAGAGGAAAGAGGG + Intronic
1085308169 11:75500171-75500193 AGGAGAGGCCAGAGGGAGGAGGG - Intronic
1085308172 11:75500178-75500200 AGGAGAGAGGAGAGGCCAGAGGG - Intronic
1085468238 11:76738718-76738740 AGGAGAGAGCAGAGCCAGGAGGG + Intergenic
1085629701 11:78104363-78104385 AGTGAAGAGCAGAGGAAAGAGGG + Exonic
1085708717 11:78810116-78810138 AGCATAGAGCAGAGGGAGGAGGG + Intronic
1085745629 11:79112008-79112030 AGGTGGGGGCAGAGAGAGGAAGG + Intronic
1085758759 11:79223819-79223841 TGGTGGGAGCAGTGGGAAAAAGG - Intronic
1085857563 11:80192759-80192781 AGGTGAGTACAGAGAGAAAAAGG + Intergenic
1085937322 11:81163864-81163886 AGGGAAGAGAAAAGGGAAGATGG + Intergenic
1086134078 11:83429563-83429585 GGGTGAGATCAGAGAGGAGAAGG + Intergenic
1086142256 11:83512207-83512229 GGGGGAGAGAAGAGGGCAGAAGG - Intronic
1086443636 11:86852017-86852039 AGGAGAGTGCAGTGGGCAGATGG - Intronic
1086477834 11:87198542-87198564 AGGGGAGAGGGGAGGGAGGAGGG - Intronic
1086758308 11:90593270-90593292 AGGTGAGTGGATAGGGAAGTAGG + Intergenic
1087158298 11:94925510-94925532 AGGAGAGAGAAGAGCGAAGGAGG + Intergenic
1087177118 11:95106184-95106206 AGGGCAGAGAAGAGGGGAGATGG + Intronic
1087263743 11:96039390-96039412 AGGAGACAGGAGAGGGGAGAGGG + Intronic
1087973195 11:104511622-104511644 AGGGGAGAGGAGAAGGAAGATGG + Intergenic
1088245289 11:107812439-107812461 AGGTGAGGGCAGAGGACAGCTGG + Intronic
1088355730 11:108942071-108942093 ATGTGAGAGCAGAGGGACAGTGG - Intergenic
1088432094 11:109769817-109769839 AGGGGAAAGAAGAGGTAAGAGGG - Intergenic
1088442731 11:109889422-109889444 AGCTGAGGGGAGAGGGATGATGG - Intergenic
1088469151 11:110175668-110175690 AGTGGAGAGCAGTGGGGAGAGGG - Intronic
1088708395 11:112484029-112484051 AGTTCAGAGCAAAGGGAAGTTGG - Intergenic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089607062 11:119647577-119647599 AGGAGCTAGGAGAGGGAAGAGGG - Intronic
1089671764 11:120061928-120061950 AGGTAAGCGCAGTGGGAAGATGG - Intergenic
1089726456 11:120484724-120484746 AGGTGAAAAGAGAGAGAAGAGGG - Intronic
1089838343 11:121391766-121391788 AGGTGAGAGAAGACAGAGGATGG - Intergenic
1089876806 11:121730255-121730277 AGGGGAGGGCAAAGTGAAGAAGG - Intergenic
1090105779 11:123852500-123852522 TGGTGAGAGCAGAAGCAAGATGG - Intergenic
1090268423 11:125369417-125369439 AGGGAAGGGCAGAGGGAAGGAGG - Intronic
1090270161 11:125380427-125380449 TGGGGAGAGAAGAGCGAAGAAGG + Intronic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1090460311 11:126885716-126885738 AGGACAGAGCAGAGGGCAGCAGG + Intronic
1090531198 11:127592689-127592711 AGAAGAGAGTAGAGAGAAGAGGG + Intergenic
1090539495 11:127685237-127685259 AGGTGCTGGCAGAGAGAAGAAGG + Intergenic
1090662407 11:128891374-128891396 GGGAGAGAGGAGAGGGAGGAGGG + Exonic
1090717051 11:129440109-129440131 GGGTGAGAGCTGTGGGAGGAGGG - Intronic
1090803644 11:130189539-130189561 CTGTGAGAGCAGAGGGCAAAGGG + Intronic
1090974636 11:131671005-131671027 AGGACAGAGCAGGAGGAAGAGGG - Intronic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091332908 11:134744557-134744579 AAGTGAGAGCAAAGGAGAGAAGG + Intergenic
1091363751 11:134999953-134999975 GGGGGAGAGCAGAGGAAATAGGG + Intergenic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091641565 12:2241072-2241094 AGGTGAGGGGGGTGGGAAGAGGG + Intronic
1091706305 12:2695637-2695659 TGGGGAGGGCAGTGGGAAGAGGG - Intronic
1091711533 12:2743866-2743888 TGGGGAGGGCAGTGGGAAGAGGG - Intergenic
1091891116 12:4055368-4055390 AAGGGAGAGCAGGGGGAAGCTGG - Intergenic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092227408 12:6756807-6756829 AGAGGAGAGGAGAGGGAGGAAGG - Intronic
1092278617 12:7081931-7081953 AGGAGAGAGAGGAGAGAAGAGGG - Intronic
1092403274 12:8196068-8196090 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1092536070 12:9388404-9388426 TGGTGACAGAAAAGGGAAGATGG - Intergenic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1092821232 12:12355551-12355573 AGGTGAGAGAGGAGGTAAAAGGG - Intergenic
1092883225 12:12904028-12904050 GGGAGAGATCAAAGGGAAGAGGG + Intronic
1092970533 12:13689950-13689972 AGAGGAGAGAAGAGGGGAGAAGG - Intronic
1093091296 12:14924006-14924028 TGGTGATGGAAGAGGGAAGAGGG - Intronic
1093743720 12:22716067-22716089 AGGAAGGAGCAGAGGGATGAAGG + Intergenic
1093927162 12:24920539-24920561 GTGTGAGAGCAGAGGAAAAATGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094193899 12:27725617-27725639 TGGTGAGAGCACAGGAAAGCAGG - Intronic
1094311179 12:29085686-29085708 AGGGGCAAGCAGAGGGAATATGG + Intergenic
1094348639 12:29498690-29498712 AGGAGAGAGCAGAGGGTAAATGG + Intergenic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1095367983 12:41430938-41430960 TGGTGAGAGCAGGAGCAAGATGG + Intronic
1095380183 12:41581632-41581654 GGGAGAGAGCAGATGGAGGAAGG + Intergenic
1095441449 12:42242252-42242274 AGCTGAGAGCTGAGGCAGGAAGG + Intronic
1095702003 12:45200354-45200376 AGGAGTGAGCACATGGAAGAAGG - Intergenic
1095726635 12:45460958-45460980 GGATTAGAGAAGAGGGAAGATGG + Intergenic
1096042983 12:48536233-48536255 ACTTGAGAGCAGAGGGAGGGAGG + Intergenic
1096414183 12:51399330-51399352 AGGTGACTGCAGATGGGAGAAGG - Intronic
1096489309 12:52005114-52005136 AGGTGGGAGGAGGGAGAAGAAGG + Intergenic
1096518205 12:52169993-52170015 AGGGGAGAGGAGAGTGAAGGAGG + Exonic
1096523179 12:52195442-52195464 GGGTGGGGGCAGAGGGAACAGGG + Intergenic
1096534381 12:52261788-52261810 TGATGAGAGCAGGGGGAAGGAGG + Intronic
1096600102 12:52723065-52723087 AGGTCTGAGCAAAGGGGAGAAGG - Intergenic
1096660105 12:53118934-53118956 AGGTGAGAAGATAGGGTAGAAGG + Exonic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1096820815 12:54232617-54232639 ACTTGGGAGCAGAGGGAAGTTGG + Exonic
1097442801 12:59632126-59632148 ACATGCTAGCAGAGGGAAGATGG + Intronic
1097790411 12:63809675-63809697 TGGCCAGAGCAGAGGGAAAAGGG + Intergenic
1098098801 12:66990478-66990500 AAGAGAGAAAAGAGGGAAGAAGG + Intergenic
1098190078 12:67938623-67938645 GGGTGAGAGTAGAGAGAAGGGGG + Intergenic
1098254785 12:68606071-68606093 AGAGGAGAGGAGAGGGGAGACGG + Intergenic
1098270827 12:68768690-68768712 ATATGAGAGCTGATGGAAGAAGG + Exonic
1098465759 12:70784081-70784103 AGCTGAGGGCAGAGGGAGCAGGG + Intronic
1098772866 12:74576706-74576728 AGGTGAGGACAGAGAGAAGGTGG + Intergenic
1098856725 12:75661165-75661187 AAGTGATAGAAGAGGGGAGAAGG - Intergenic
1099156332 12:79180991-79181013 AGGAGAATGCAGAGTGAAGAGGG - Intronic
1099424298 12:82503597-82503619 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1099442147 12:82712072-82712094 AGGTGAGTGCAGAAAGGAGAGGG - Intronic
1099880447 12:88461010-88461032 AGGGGAGAGCCAAGTGAAGATGG - Intergenic
1100093737 12:91005989-91006011 AGATGGGAGCAGAGGCAGGAAGG - Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100506928 12:95230516-95230538 AGGTGAGAGGAGAGGATAGCTGG - Intronic
1100744782 12:97633755-97633777 TGGTGAGGGCAGAGGGAGTAAGG + Intergenic
1100748133 12:97667916-97667938 TGGTGAGCGCAGAGCGAAGAGGG + Intergenic
1101211095 12:102535549-102535571 AGGTGAGGGCAGCGTGATGAAGG + Intergenic
1101321652 12:103678160-103678182 AGGTCAGAACACACGGAAGATGG + Intronic
1102459106 12:113089323-113089345 GAGTGAGAGCAGAGGACAGATGG + Intronic
1102546978 12:113664381-113664403 AGGTCTGAGCAGAAGAAAGAAGG + Intergenic
1102598773 12:114012992-114013014 AGGAGGGAGGAGAGGGAGGAGGG + Intergenic
1102669087 12:114601859-114601881 AGGAGAGAGAAGAGTGAAGGAGG - Intergenic
1102670547 12:114615267-114615289 AGGTGAGAGCAGAGGTGACAGGG + Intergenic
1102814415 12:115852570-115852592 AGGTAAGAGGAGTAGGAAGATGG - Intergenic
1102899319 12:116624071-116624093 AGGTGAAGGAAGAAGGAAGAAGG + Intergenic
1103019324 12:117521120-117521142 AGGTGAGGGCAAAGGGGAGAAGG - Intronic
1103023692 12:117556707-117556729 AAGTGAGAGGACAGGGAAGGAGG + Intronic
1103056620 12:117826092-117826114 AGGAAAGAGCAAAGGGGAGATGG + Intronic
1103191555 12:119006224-119006246 AGTTGAGAGCAGATGGAAAAGGG - Intronic
1103344772 12:120241866-120241888 AGGGGAGATCAGAGGGAGGCAGG + Intronic
1103366967 12:120390568-120390590 AAGGGAGGGAAGAGGGAAGAAGG + Intergenic
1103451319 12:121031397-121031419 AGGGGCAAGGAGAGGGAAGAGGG - Intronic
1103512351 12:121484105-121484127 AGGTGGGAGGAGAGGGAGGCGGG - Intronic
1103767605 12:123292435-123292457 AGTGGAGGGGAGAGGGAAGAAGG + Exonic
1104066854 12:125313611-125313633 AGGGGAAAGGAGAGGGGAGAGGG - Intronic
1104225064 12:126823530-126823552 CGGAGAGAGGAGAGGGAACAAGG - Intergenic
1104399837 12:128466186-128466208 AGGGGAGAGCACAGGAAAGAAGG + Intronic
1104529390 12:129554612-129554634 AGGTGACAGTAGAGAGAAGGTGG - Intronic
1104532111 12:129581652-129581674 AGGATAAAGCAGATGGAAGAAGG - Intronic
1104544492 12:129698714-129698736 AGGGGAGGGGAGAGGGGAGAAGG + Intronic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104729849 12:131098679-131098701 AGGTGACTGCAGAGGGAAGAGGG - Intronic
1104820542 12:131675017-131675039 AGGAGAGGGGAGAAGGAAGATGG - Intergenic
1105003004 12:132703303-132703325 AGGTGAGAAGTGATGGAAGAAGG + Intronic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1105764590 13:23546918-23546940 AGGGGAGAGAGGAGGGAGGAAGG - Intergenic
1105885451 13:24637806-24637828 AGGTGAGGGCTGAGGGACGAGGG + Intergenic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1106269280 13:28138476-28138498 AGGGGAGAGGGGAGGGAGGAGGG - Intergenic
1106310404 13:28549205-28549227 AGGTGAGACAGGAGGGAACAAGG + Intergenic
1106384962 13:29275496-29275518 GGGTGGGAGCAGAGGGAGTAGGG - Intronic
1106471024 13:30054210-30054232 ATGTGAGGGCAAGGGGAAGAAGG + Intergenic
1106471703 13:30061717-30061739 AGAAAAGAGCAGAGGCAAGAAGG + Intergenic
1106667769 13:31870603-31870625 AAGTGAGAGAGGAGGCAAGAGGG + Intergenic
1106784309 13:33091914-33091936 AGGTGAGAGCCCAGGGAGAAGGG - Intergenic
1106834215 13:33616209-33616231 AGAGGAGAGGAGAGGGAAAAGGG + Intergenic
1106953245 13:34907715-34907737 AGGGGAATACAGAGGGAAGAAGG - Intergenic
1107346885 13:39471437-39471459 AAGTGAGAGCAGAAACAAGAGGG + Intronic
1107392622 13:39982895-39982917 TGGTGACAGCAGAGTGGAGAAGG + Intergenic
1107546322 13:41436805-41436827 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1107816836 13:44252036-44252058 AGGTGGGAGCAGAGGCGACAGGG - Intergenic
1108299745 13:49061651-49061673 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299751 13:49061663-49061685 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299757 13:49061675-49061697 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299763 13:49061687-49061709 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108348299 13:49567235-49567257 AGGGGAGAGTAGAGTGAAGATGG + Exonic
1108447802 13:50526854-50526876 GGGAGAGGGGAGAGGGAAGAGGG + Intronic
1108496268 13:51028309-51028331 AGTGGAGAGGACAGGGAAGAAGG - Intergenic
1109198626 13:59407002-59407024 ACTTGAGGGCAGAGGGTAGAAGG - Intergenic
1109464843 13:62716819-62716841 AGGTGATAGGAGAGGTAGGAGGG - Intergenic
1109982117 13:69923022-69923044 AGGTGGGAGGAGACAGAAGATGG + Intronic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1110694493 13:78472323-78472345 AGATGTCAGCAGAGGAAAGAGGG - Intergenic
1111174148 13:84571431-84571453 AGGAGAGAGAAGAGTGAAGGAGG + Intergenic
1112102111 13:96200534-96200556 TGGGGAGAGAAGAGGAAAGATGG - Intronic
1112281155 13:98064235-98064257 AGTTGGGAGCAGGGGGATGAGGG - Intergenic
1112414728 13:99194834-99194856 AGGTGAAAGCAAGGGGAAGGTGG + Intergenic
1113077820 13:106485326-106485348 AGGTGAGAAAGGAAGGAAGAAGG - Intergenic
1113139396 13:107130342-107130364 AGGTGAGAGGAGAAGAAACACGG - Intergenic
1113258041 13:108528781-108528803 AAGAGAGAGAAGAGAGAAGAGGG - Intergenic
1113386595 13:109854502-109854524 AGGAGAGAGAAGGGGGGAGAGGG - Intergenic
1113509250 13:110839186-110839208 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1113532890 13:111042346-111042368 AGGTAAGAGGAGAGGGAACTGGG - Intergenic
1113726156 13:112603853-112603875 AGAAGAGGGCAGAGGGAGGATGG + Intergenic
1113794252 13:113047801-113047823 AGGTGTGAGCAGAGGGGACGGGG - Intronic
1113794259 13:113047835-113047857 AGGCGTGAGCAGAGGGGACAGGG - Intronic
1113869639 13:113551301-113551323 AGGCGCGTGCACAGGGAAGATGG - Intronic
1113990426 14:16023896-16023918 AGGAGAGAACAGAGGGAGGGAGG - Intergenic
1114197989 14:20495724-20495746 AGGGGAGAGCAGGGAGAGGAAGG - Intergenic
1114317515 14:21522399-21522421 AGGAGAGAGGAGGGGGAAGAAGG + Exonic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1114683662 14:24507626-24507648 AGGAGACAGGAGAGGGAAGATGG - Intronic
1115140679 14:30167979-30168001 TGGTGAAAGCAGGAGGAAGAAGG + Intronic
1115434437 14:33357165-33357187 ATGTGAAATTAGAGGGAAGATGG + Intronic
1115498275 14:34027420-34027442 AGGGGAGGGGAGGGGGAAGAAGG + Intronic
1115539954 14:34411258-34411280 GGGAGAGGGGAGAGGGAAGAGGG - Intronic
1115697764 14:35919055-35919077 GGGAGAGAGAAGGGGGAAGAAGG + Intronic
1115724154 14:36194673-36194695 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
1116152981 14:41165792-41165814 AGTTTGGAGCAGGGGGAAGAAGG - Intergenic
1116300716 14:43178536-43178558 AAGGGAGAGCATAGGCAAGAAGG - Intergenic
1117528285 14:56633363-56633385 TGGGGAGAGAGGAGGGAAGAGGG + Intronic
1117617271 14:57546404-57546426 AAGTGAGAGGAAAGGGAGGAAGG + Intergenic
1118093666 14:62511995-62512017 AGGTGATAGCAGAGGCTAGGGGG + Intergenic
1118232453 14:63965833-63965855 AGATCAGAGCTAAGGGAAGAAGG - Intronic
1118261260 14:64248972-64248994 AGGAAAGAGCAGAGGGAAGTAGG - Intronic
1118276383 14:64389201-64389223 AAATGAGAGTAGAAGGAAGAGGG + Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118570027 14:67185263-67185285 AGGAGAAAGAAGAGGAAAGAAGG + Intergenic
1118785009 14:69038438-69038460 AGGGAAGAGGAGAGGGCAGAGGG + Intergenic
1119217833 14:72882798-72882820 AGGTGAGGGGAGTGGGGAGAGGG - Intronic
1119318881 14:73717908-73717930 AGGTCAGAGCAGAGGCAAGGAGG + Exonic
1119383857 14:74245304-74245326 AGGGGAGAGTGGAGGGGAGAGGG - Intronic
1119537418 14:75413831-75413853 TGGTTAGAGCAGAGGTCAGAAGG + Intergenic
1119726503 14:76924780-76924802 AGGTGAGGGCAGAGTCAAGCTGG + Intergenic
1119878594 14:78081422-78081444 AGGTGAGGGAACAGTGAAGAGGG + Intergenic
1120041211 14:79754881-79754903 AGGGAAGAGCAGAGCGAAGGGGG - Intronic
1120515605 14:85465926-85465948 TGGTGAGAGAGGAGGCAAGACGG - Intergenic
1120738170 14:88078598-88078620 AGGGCAGAAGAGAGGGAAGAAGG - Intergenic
1120817144 14:88872904-88872926 AGATGAGAGCAGTCTGAAGAAGG - Intronic
1121017448 14:90557124-90557146 AGGTAGAAGCAGAGGGCAGATGG - Intronic
1121069316 14:91002801-91002823 GGCTGAGAGAAGAGGGAAGAGGG - Intronic
1121222848 14:92299436-92299458 AGGTGAAAGCACAGGGAAGTGGG - Intergenic
1121258945 14:92552533-92552555 AGGTGAGAGCAGAGGGGGTAGGG - Intronic
1121296730 14:92832445-92832467 AGATAAGACCAGATGGAAGATGG + Intronic
1121529084 14:94640119-94640141 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
1121539170 14:94712212-94712234 GGGTGAGTGCAGAGAGAGGAAGG - Intergenic
1121599179 14:95190510-95190532 AGGAGAGAGCAGAGGGAGCCTGG + Exonic
1121777096 14:96598200-96598222 AGAGGAGAGGAGAAGGAAGAGGG - Intergenic
1121786598 14:96666184-96666206 AAAGGAGAGCAAAGGGAAGACGG - Intergenic
1121800323 14:96769123-96769145 AAGGGAGAGGGGAGGGAAGAAGG - Intergenic
1121994338 14:98590440-98590462 AGATGGGAGCAGAAGGGAGATGG + Intergenic
1122027335 14:98887229-98887251 AGATCAGAGCAGGGGGCAGAAGG + Intergenic
1122238033 14:100344063-100344085 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1122268487 14:100557675-100557697 AGGAGACAGCAGCGGGCAGATGG + Intronic
1122392797 14:101401839-101401861 AGAAGAGGGAAGAGGGAAGAGGG - Intergenic
1122441741 14:101736806-101736828 AGGACAGAGCAGGGGGAAGCAGG + Intergenic
1122501354 14:102202154-102202176 AGGAGAGAGCACAGGGAAGCAGG - Intronic
1122723023 14:103732593-103732615 AGGAGAGAGACGAGGTAAGACGG - Intronic
1122845979 14:104499316-104499338 AGGAGAGAGAAGAGCGAAGGAGG + Intronic
1122923279 14:104888702-104888724 AGGTGGGTGCACAGGGCAGAAGG - Intronic
1122941796 14:104984815-104984837 GGGTGAGGGCAGATGGCAGAAGG + Intergenic
1122961630 14:105096510-105096532 AGGTGAGAGAAGAGGGCTCAGGG - Intergenic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123113215 14:105882524-105882546 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123115568 14:105892675-105892697 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123402551 15:20002960-20002982 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123434958 15:20247949-20247971 AGGAGAGAGGAGAGGGAGGACGG + Intergenic
1123511889 15:21009614-21009636 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123792328 15:23734265-23734287 AGAAGAAAGAAGAGGGAAGATGG + Intergenic
1123904322 15:24906956-24906978 AGGGGAGGGCAGAGGGAGGGAGG + Intronic
1124045499 15:26146337-26146359 TGGTGACAGCAGAAGGAAGGTGG - Intergenic
1124237455 15:28002728-28002750 ATGTAAGAGCAGAGGAAAGCAGG - Intronic
1125512420 15:40299244-40299266 AGGTGAGGGCAGGGGCAATAAGG - Intronic
1125697484 15:41651606-41651628 AGGAGAGAGGAGAGGGGAAAAGG - Intronic
1125697674 15:41652361-41652383 AGGAGAGGGGAGAGGGGAGAAGG - Intronic
1125920781 15:43524434-43524456 AGATGACAGCACAGTGAAGATGG + Exonic
1126023618 15:44426009-44426031 ATGGGAGGGCAGGGGGAAGATGG - Intergenic
1126105513 15:45144539-45144561 AGATAAGAGGACAGGGAAGAGGG - Intronic
1126379961 15:48036384-48036406 AGCTGACAGGAGAGGGAAGAAGG + Intergenic
1126416603 15:48424358-48424380 AGTGGAGAGCAGAGAGAAGTTGG - Intronic
1126524019 15:49630185-49630207 TGGTGAGAGGAGAAGGAAGAAGG + Intronic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1126667188 15:51086210-51086232 TGGTGAGAGAGGAGAGAAGAAGG - Intronic
1126697668 15:51340026-51340048 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1127040669 15:54973161-54973183 TGGTGATAGGAGAGAGAAGAAGG + Intergenic
1127044160 15:55008540-55008562 AGGGGAGAGCAGAGGAGGGAAGG - Intergenic
1127088944 15:55447799-55447821 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127088952 15:55447820-55447842 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127088960 15:55447841-55447863 GGGAGAGGGCAGAGGGGAGAGGG + Intronic
1127657780 15:61071625-61071647 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128034073 15:64507775-64507797 AATAGAGAGCAGAGGGAAGATGG + Intronic
1128185198 15:65638790-65638812 AGTTCAGATCAGAGGGATGAGGG + Intronic
1128230130 15:66028999-66029021 AGGAGAGAGAGGAGGGGAGAAGG + Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128711918 15:69878558-69878580 AGGTGAGGGGAGAGGGAACCTGG + Intergenic
1128867274 15:71123739-71123761 AGGTTGGGGGAGAGGGAAGAGGG + Intronic
1129022146 15:72530063-72530085 AATTGATAGCAGAGGGTAGATGG + Intronic
1129166849 15:73783369-73783391 AGGAGAGGGCAGAGGGCAGGTGG - Intergenic
1129460347 15:75697275-75697297 AGGATGGGGCAGAGGGAAGAGGG - Intronic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129672969 15:77617264-77617286 TGGAGAGAGAAGAGGGAAGGAGG - Intronic
1129790150 15:78335704-78335726 AGGTGAGTGCTGAAGGAAGCAGG - Intergenic
1130006839 15:80107822-80107844 AGAGGAGAGGAGAGGGGAGAGGG + Intronic
1130096590 15:80860801-80860823 TGGTGAGGTCAGAGGGCAGAGGG - Intronic
1130233403 15:82113622-82113644 AGGAGAGAGTAGAGGGAATGGGG - Intergenic
1130459981 15:84153661-84153683 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1130846221 15:87748711-87748733 AGATGAGAGCAGAGTGAAGACGG + Intergenic
1130994887 15:88898140-88898162 GGTAGAAAGCAGAGGGAAGAGGG + Intergenic
1131097715 15:89666627-89666649 AGTTGAGAGCAAAGGGGTGAAGG + Intronic
1131173348 15:90193754-90193776 AGGTGAGTGCAGTAGGCAGAAGG + Intronic
1131491462 15:92866885-92866907 AGGTCAGAGCAGGAAGAAGAGGG + Intergenic
1131535338 15:93232589-93232611 AGGAGAGAGCAGAGGATACAGGG + Intergenic
1131603282 15:93872201-93872223 GTGAGAGAGCAGAGAGAAGAGGG - Intergenic
1132068950 15:98758584-98758606 AGGTGAAACCAGAGGGAAGGGGG - Intronic
1132126374 15:99229466-99229488 AGGAAACAGCACAGGGAAGAGGG + Intronic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1132520304 16:384187-384209 AGGGGAGGGCAGTGGGAGGAGGG - Intronic
1132676771 16:1124294-1124316 AGGGGAGAGAAGAGGGAGGCTGG + Intergenic
1132716452 16:1292562-1292584 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1132771740 16:1567399-1567421 TGGGGACAGCAGAGGGCAGAGGG - Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133392825 16:5423007-5423029 AGGAGAAAGGAGAGGGAGGAAGG + Intergenic
1133392837 16:5423036-5423058 AGGAGTGGGGAGAGGGAAGAGGG + Intergenic
1133647247 16:7775856-7775878 AGGGGAGAGCAGGGGGAAGAGGG + Intergenic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1134311168 16:13076462-13076484 AGGAGGGAGCAGGGGGAAGTGGG - Intronic
1134523274 16:14927992-14928014 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134523281 16:14928010-14928032 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134523288 16:14928028-14928050 GGGGGAGAGGAGAGGGAAGGGGG - Intronic
1134711204 16:16327591-16327613 AGGTGCAGGCAGAAGGAAGAGGG - Intergenic
1134948370 16:18340992-18341014 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1134955625 16:18381102-18381124 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1135241691 16:20812652-20812674 AGGTATGAGGAGAGGGAAGCAGG - Intronic
1135478054 16:22795236-22795258 TGGTGAGAGGAGAGGGTAGCAGG - Intergenic
1135496008 16:22951674-22951696 AGGAGAGAGAAAAGGAAAGATGG - Intergenic
1135666380 16:24338813-24338835 AGGTGAAAGGAGAGGGGTGATGG - Intronic
1135817464 16:25648454-25648476 ACATTAGAGCAGAGGGAAAAGGG + Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135892702 16:26371736-26371758 AGAGGAGAGGAGAGGAAAGAGGG + Intergenic
1136031194 16:27504301-27504323 AGGGGATGGCAGAGGGAGGAAGG + Intronic
1136054496 16:27678405-27678427 AGGAGAGGGAAGAGGGGAGATGG - Intronic
1136054498 16:27678412-27678434 AGGGAAAAGGAGAGGGAAGAGGG - Intronic
1136139279 16:28278258-28278280 AGGGGAGAGCAGGGGGAGGTAGG + Intergenic
1136143136 16:28299857-28299879 AGATGAGAGCAGAGGTGAGAAGG - Intronic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1136298956 16:29320572-29320594 AGTTCAGGGCAGAGGGAAGTTGG + Intergenic
1136394470 16:29985633-29985655 GGGCGAGTGCAGAGGGAAGCAGG - Intronic
1136417568 16:30113150-30113172 AGGTGAGGCCAGAGGGAGGATGG - Intronic
1136849678 16:33603083-33603105 AGGAGAGAGGAGAGGGAGGACGG - Intergenic
1136849755 16:33603302-33603324 AGGGGAGGGGAGAGGGGAGAGGG - Intergenic
1137274248 16:46923124-46923146 AGGTGAGTGCAGAGAGAAGGGGG - Intronic
1137475945 16:48810627-48810649 AGGTGAGCGCAGAGGAGAGGAGG - Intergenic
1137610963 16:49817235-49817257 AGGGGAGAGCAGGGGGAGGCAGG + Intronic
1137784294 16:51125186-51125208 AGGAGAGGGCAGAGGGAAGGTGG + Intergenic
1137912311 16:52390432-52390454 AGGGGAGGGCGGAGGGAAGATGG + Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138104556 16:54280896-54280918 AGGTGACAGCAGAGGTTAGGTGG - Intergenic
1138114769 16:54351623-54351645 AGGAGAGAGGAGAGGGAGGAAGG - Intergenic
1138116289 16:54363041-54363063 GGGTGAGAGCAAGGGGAAGAGGG - Intergenic
1138423456 16:56914877-56914899 AGGTGAAAGGAGAGGGGAGGAGG + Exonic
1138445321 16:57059607-57059629 AGGAGAGGGCCCAGGGAAGAGGG - Intronic
1138484107 16:57325052-57325074 ATGTGAGAGAAAAGGGAAGGAGG + Intergenic
1138496842 16:57414001-57414023 AGGTGAGAGCAGGGGACAGGTGG + Exonic
1138544029 16:57705734-57705756 AGGAGAGATCAGAGGGTGGATGG - Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1138811508 16:60156117-60156139 AGGTTAGAGAAGAGGGAGGGAGG + Intergenic
1138813773 16:60180769-60180791 AGGGGAGAGAAGAGGAAGGAAGG - Intergenic
1139317969 16:66089729-66089751 TGGAGAGAGCACAAGGAAGATGG + Intergenic
1139330319 16:66183550-66183572 AGGAGAGAGGAGAAGGAGGAAGG + Intergenic
1139377433 16:66508982-66509004 ACGTGGGGGCAGAGGGGAGAGGG + Exonic
1139612230 16:68067267-68067289 AGGGGAGAGGAGAGGGGAGGGGG - Intronic
1139986986 16:70906788-70906810 AGGAGAGGGCAGAAGGATGAGGG - Intronic
1139999143 16:71009254-71009276 AGGGCAGAGCCGAGGGATGATGG + Intronic
1140058469 16:71546410-71546432 ATGTGATAGAAGAGGAAAGACGG - Intronic
1140345107 16:74205914-74205936 AGAGGAGAGCAGAGCAAAGATGG + Intergenic
1140477661 16:75247086-75247108 AGGTGGGGGCAGAGGGGAGAAGG - Intronic
1140479873 16:75256798-75256820 AGGGGAGAGCTGAGAGAGGAGGG - Intronic
1140793208 16:78411886-78411908 AGGAGAGCGGAGAGGGAAGCAGG + Intronic
1140855912 16:78977608-78977630 AGGGGAGAGGAGATAGAAGAAGG + Intronic
1140896030 16:79325015-79325037 AGGGGAGAGAAGAAGGAACAGGG - Intergenic
1140914602 16:79482917-79482939 AGGGGAGAGGAGAGGGAGGGAGG - Intergenic
1141027394 16:80561114-80561136 ATGTGAGTGCCAAGGGAAGAGGG - Intergenic
1141042085 16:80681348-80681370 AGGTTAGGGAAGAGGGTAGAAGG + Intronic
1141155471 16:81593927-81593949 AGGTAAGGGTAGAGGGAAGAGGG - Intronic
1141298329 16:82790752-82790774 AGGAGAGTGCCAAGGGAAGAGGG + Intronic
1141372171 16:83498164-83498186 AGGTGAGAGGAGAGGGGGCAAGG + Intronic
1141527064 16:84618317-84618339 AGGAGAGAGAAGAGGGATGTTGG - Intergenic
1141637337 16:85321316-85321338 AGGAGAGAGGAGGGCGAAGAAGG + Intergenic
1141686914 16:85575464-85575486 AGGGGAGACGAGAGGGAAGCCGG - Intergenic
1141713909 16:85716268-85716290 AGGAGAGAACGGAGGGAAGGAGG + Intronic
1141795969 16:86274501-86274523 AGGTAAGAACAGAGGGCAGGGGG - Intergenic
1141838978 16:86562162-86562184 AGGTGGGGTCAGAGGGGAGAAGG - Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1141988086 16:87593002-87593024 AGAGGAGAGGAGAGGGAGGAGGG - Intergenic
1142008232 16:87700545-87700567 AGAAGAGGGCAGAGGGAAGAGGG + Intronic
1142060641 16:88027127-88027149 AGCTCAGGGCAGAGGGAAGTTGG + Intronic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142313087 16:89325429-89325451 AGGAGAGGGGAGAGGGGAGAGGG - Intronic
1142402973 16:89870693-89870715 AAGGGAGAGCAGAGGCAAGCAGG - Exonic
1203111345 16_KI270728v1_random:1451616-1451638 AGGGGAGGGGAGAGGGGAGAGGG - Intergenic
1142488955 17:265558-265580 AAGGGAGGGAAGAGGGAAGAGGG - Intronic
1142608761 17:1096663-1096685 AGGAGAGAGCTGGGGGAAGGTGG + Intronic
1142622084 17:1171617-1171639 AGGTGAGGGCAGGGACAAGAAGG + Intronic
1142690669 17:1604719-1604741 AGGTGAGGGCAGGGGGCAGATGG - Intronic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1143528514 17:7486256-7486278 AGGAGAGACCAGAGAGAGGAGGG + Intronic
1143538881 17:7558032-7558054 AGGTGGGAGCAGAGGTAGGAAGG + Intronic
1143709143 17:8721874-8721896 GGGTGAGAACAGAGGCAAGCAGG - Intergenic
1143784036 17:9243696-9243718 AGGAGGGGGCAGAGGGAGGAGGG - Exonic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1144163986 17:12589848-12589870 AGGTGCAAGCAGAGAGAAGCTGG + Intergenic
1144376716 17:14650197-14650219 TGGTAAGAGCAGGGAGAAGAGGG + Intergenic
1144388621 17:14772859-14772881 AACTGAGAGCAGAAGGCAGAAGG + Intergenic
1144406601 17:14957997-14958019 TTGTGACAGCAGTGGGAAGAAGG - Intergenic
1144746729 17:17620912-17620934 AGGAGAGGGGAGAGGGGAGAGGG + Intergenic
1144792116 17:17866307-17866329 AGCTGGGAGGAGAGGGAAGATGG + Exonic
1144843903 17:18205954-18205976 AGGTGGGAGCAAAGGGCAGAAGG - Intronic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1145824483 17:27866615-27866637 AGGAGAGAGAAAAGGGAGGAAGG - Intronic
1145977434 17:28992591-28992613 AGGAGAGGGCAGAGTGAAAAAGG - Intronic
1146424163 17:32719961-32719983 AGATCAGAGCAAAGAGAAGATGG - Intronic
1146691863 17:34882399-34882421 GGGTGAGGGCAGAGGGAAGGGGG - Intergenic
1146809333 17:35890750-35890772 AGGTGACAGAAGAGGGGAGGGGG - Intergenic
1146824187 17:36009179-36009201 AGCTGGGAGGAGAGGGGAGAAGG - Intergenic
1146908607 17:36633514-36633536 GGGAGAGAGGAGAGGGAGGAGGG + Intergenic
1146929915 17:36769486-36769508 AGGTGAGGGGAGAAGGAAAAGGG + Intergenic
1147007330 17:37414032-37414054 AGGTGAGATCAGAGGGTATTTGG + Intronic
1147318244 17:39631337-39631359 AGGTCCAAGAAGAGGGAAGAAGG + Intronic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1148028166 17:44602401-44602423 AGGACAAAGCTGAGGGAAGAGGG - Intergenic
1148384916 17:47227518-47227540 AGGTGAAAGGAGAGGCAGGAGGG - Intergenic
1148466248 17:47866844-47866866 AGGAGAGGGCAGTGGGGAGATGG + Intergenic
1148582282 17:48752348-48752370 AGGTGACAGGAGAGGGAGGAAGG + Intergenic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1148738426 17:49878208-49878230 AGTTGACAGGAGAGGGAAGAGGG + Intergenic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149804730 17:59605615-59605637 AAGTGAGAGAAGATGCAAGAAGG + Exonic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150341724 17:64373946-64373968 AGGCAACAGCAGAGGGAAGCTGG - Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150568633 17:66365310-66365332 AGGAGAGAGAAGTGGGAGGAAGG + Intronic
1150642307 17:66957840-66957862 AGGTGAGAGCCCAGGGAGGCTGG + Intergenic
1150839738 17:68596690-68596712 AGGAAAGTGCACAGGGAAGAAGG - Intronic
1150947663 17:69765535-69765557 AGAGGAGAGGGGAGGGAAGAAGG - Intergenic
1151174201 17:72273795-72273817 AGCCAGGAGCAGAGGGAAGAGGG + Intergenic
1151327813 17:73389713-73389735 TGGGGAGGGGAGAGGGAAGATGG + Intronic
1151430763 17:74060970-74060992 AGAGGAGAGCAGAAAGAAGAAGG - Intergenic
1151535023 17:74734249-74734271 AGGTGAAGACAGAGGCAAGATGG - Intronic
1151765356 17:76130876-76130898 TGGTGAGAGCAGGAGGAAGAGGG - Intergenic
1151944930 17:77314570-77314592 AGGTGAGGGGACATGGAAGATGG + Intronic
1152207277 17:78980867-78980889 GGGGCAGAGCAGAGGGAAGCAGG + Intergenic
1152708100 17:81855790-81855812 TGGGGAGTGGAGAGGGAAGAGGG + Intronic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1153051761 18:907495-907517 GGGTGGGAGCAGAGGTAAGGAGG - Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1153519947 18:5942113-5942135 AACTGAGAGGAGAGGGGAGAAGG + Intergenic
1153577708 18:6539342-6539364 AGGAGAGAGAGGAGGGAAGCAGG + Intronic
1154109381 18:11552656-11552678 GGGTGAGAGCAGTGGGCACACGG - Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154157984 18:11959003-11959025 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154494261 18:14944347-14944369 AGGGAAGAGCAGAGGGAGGGAGG - Intergenic
1155521239 18:26671201-26671223 AGGGCAGAGCAGAGGGAAAATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1155982339 18:32194490-32194512 AGAGGAGAGGGGAGGGAAGAGGG - Intronic
1156111726 18:33735668-33735690 AGGCAAAAGCAGAGGGAAGAAGG - Intronic
1156310699 18:35919192-35919214 ATGTTAGAGGAGAGGGGAGAGGG + Intergenic
1156463057 18:37332481-37332503 TGGGGAGAGCAGAGAGAAGGAGG - Intronic
1156463238 18:37333353-37333375 AAGGGAGAGGAGGGGGAAGAGGG - Intronic
1156463576 18:37335005-37335027 AGGGGGGAGCAGAGGGAGGGAGG - Intronic
1156489294 18:37486812-37486834 TGGTGAGAGCAGAGGAATGCGGG - Intronic
1156492012 18:37501899-37501921 TGGTGAGAGAAGGGGGAAAATGG - Intronic
1156569595 18:38238348-38238370 ACATGAGAGCAGAGGGAAATGGG + Intergenic
1157075958 18:44467804-44467826 AGGGCAGAGCAGAGGGGAGGAGG - Intergenic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1157291944 18:46415898-46415920 AGGTGGGAGGAGAGGTAAGCAGG + Intronic
1157443525 18:47728155-47728177 AGGAGAGTTCAGAGGGTAGAGGG + Intergenic
1157856608 18:51110407-51110429 AGGAGGGAGGAGAGGGAAGAGGG + Intergenic
1157911367 18:51620169-51620191 TGGTCAGAGCACAGGGAAGCTGG + Intergenic
1158219423 18:55134928-55134950 AGGAGAGAACAGAGGAGAGAAGG - Intergenic
1158219959 18:55140311-55140333 AGGAGAGGGGAGAGGGGAGAGGG + Intergenic
1158431909 18:57396759-57396781 GGGTGAGAGGAAGGGGAAGAAGG + Intergenic
1158452001 18:57574982-57575004 GGGTGAGAGGGGAGGGAACAGGG - Intronic
1158678167 18:59541802-59541824 TGGTGATAGCAGCTGGAAGAAGG - Intronic
1158727016 18:59983016-59983038 AGGTGAGAGAAGAATGAAGGAGG - Intergenic
1159553459 18:69921188-69921210 AGGTGAGGGCAGAGAGAAGGAGG - Intronic
1159726995 18:71973563-71973585 AAGAGAGAACAGAGGGAAAAGGG + Intergenic
1159915392 18:74183162-74183184 AGTGGAGAGGAGCGGGAAGAGGG - Intergenic
1159936453 18:74371959-74371981 GGGTGAGAGGAGAGGCAAAAGGG + Intergenic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1160497311 18:79383146-79383168 AGCTGAGAGCTGAGCGATGACGG - Intergenic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1160975472 19:1790398-1790420 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1161093826 19:2377446-2377468 AGGGGAGAGGGGAGGGGAGAAGG - Intergenic
1161093831 19:2377458-2377480 AGGAGAGGGGAGAGGGGAGAGGG - Intergenic
1161093834 19:2377465-2377487 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
1161093863 19:2377529-2377551 AGGGGAGGGGAGAGGGGAGAGGG - Intergenic
1161093866 19:2377536-2377558 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1161093912 19:2377637-2377659 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1161523417 19:4738573-4738595 AGGTGGGAGAAGAGGGGGGAGGG + Intergenic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161934391 19:7362636-7362658 TGGTGAGGGGAGGGGGAAGATGG - Intronic
1162111937 19:8404113-8404135 AGGGGAGGGGAGAGGGGAGAGGG - Exonic
1162410036 19:10500087-10500109 GGGAGAGAGCACAGGGCAGAGGG + Intronic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1163007722 19:14406959-14406981 AGGTGAGAGGAGAGGCTGGAAGG + Exonic
1163196565 19:15725647-15725669 AGGTGAGAACACAGAGAAAAGGG - Intergenic
1163329401 19:16627382-16627404 AGCCGAGAGGAGGGGGAAGAAGG + Intronic
1163358383 19:16829664-16829686 AGGTGAGAGGTGAGGGGTGAGGG - Intronic
1163860241 19:19738990-19739012 AGCTGAGGGCAGAGGGCTGAGGG - Intergenic
1163945686 19:20531254-20531276 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
1164431868 19:28196006-28196028 AGAGGAGATCAGAGGGAAGGAGG - Intergenic
1164465399 19:28483355-28483377 AGGAGAGAGAAGAGGGCAGAGGG - Intergenic
1164803721 19:31099607-31099629 AGGTAAGAGGACAGGGAAGCAGG + Intergenic
1164927087 19:32139193-32139215 AGGTGAGACCCGAGTGAAGCTGG - Intergenic
1164932516 19:32186521-32186543 AGGTCAGTGTAGGGGGAAGAGGG + Intergenic
1165107797 19:33484031-33484053 AGGGGAGAGAAGAGAGAAGGGGG + Intronic
1165172965 19:33906415-33906437 AGGGGAGAGAATAGGGAAGAGGG + Intergenic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165326455 19:35117001-35117023 AGGGGATAGCAGAGGGCAGGTGG + Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1165739715 19:38197985-38198007 AGGCGAGAACAGAGGCAACACGG - Intronic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166299450 19:41905826-41905848 TGGTGAGACCAGAGGGATGCTGG + Exonic
1166305028 19:41932615-41932637 TGGGGAGAGCAGAGGGAATGGGG + Intergenic
1166336940 19:42114043-42114065 AGATCAGAGCTGAGGGAAGCTGG + Intronic
1166459010 19:42969541-42969563 AGATGAGAGCAGGGGTAAGAAGG + Intronic
1166475953 19:43124817-43124839 AGATGAGAGCAGGGGTAAGAAGG + Intronic
1166690955 19:44821010-44821032 GGGAGAGGGAAGAGGGAAGAGGG - Exonic
1167305755 19:48708435-48708457 TGTTGAGATCAGAGGAAAGAAGG + Intergenic
1167366566 19:49057757-49057779 AGGTTAGAGGAGCGGGAGGAAGG - Exonic
1167575676 19:50316359-50316381 AGGTGAGGGCAGATGTAGGAGGG + Intronic
1167623107 19:50569495-50569517 AGGTGAGAGGAGAGTGAGTAGGG - Intergenic
1167636399 19:50658479-50658501 CGGTGAGATCAGAGAGAAGGAGG + Intronic
1167639369 19:50672233-50672255 AAGGGAGAGCAGTGTGAAGACGG + Intronic
1167700127 19:51038463-51038485 AGGGGAGAGGAGAGGAAAGCAGG - Intergenic
1168197600 19:54787070-54787092 ACATGAGAGGAGAAGGAAGAGGG + Intronic
1168246745 19:55116417-55116439 AGCAGAGAGCAAGGGGAAGAGGG + Intronic
1168414650 19:56160481-56160503 AGGAGAGAGAAGAGGGGGGAAGG - Exonic
1202700333 1_KI270712v1_random:159244-159266 AGCACAGAGCAGAGGGCAGAGGG + Intergenic
924998716 2:386827-386849 GGGAGAGGGCAGAGGGCAGAGGG - Intergenic
924998725 2:386855-386877 GGGAGAGGGCAGAGGGCAGAGGG - Intergenic
924998729 2:386869-386891 GGGAGAGGGCAGAGGGGAGAGGG - Intergenic
924998737 2:386890-386912 AGCAGAGGGCAGAGGGCAGAGGG - Intergenic
924998739 2:386897-386919 GGCAGAGAGCAGAGGGCAGAGGG - Intergenic
924998746 2:386925-386947 GGGAGAGCGCAGAGGGCAGAGGG - Intergenic
925091107 2:1156663-1156685 AGGTGAGGGCAGAAGGACGAGGG + Intronic
925289251 2:2735979-2736001 AGAGGAGAGCCCAGGGAAGATGG + Intergenic
925289278 2:2736156-2736178 AGAGGAGAGCCCAGGGAAGATGG + Intergenic
925289312 2:2736370-2736392 AGAGGAGAGCCCAGGGAAGATGG + Intergenic
925703933 2:6666321-6666343 AGGAGAGAGAAGAGTGAAGGAGG + Intergenic
925973223 2:9122272-9122294 AGGTGAGAGAGGAGAGGAGAGGG + Intergenic
926109410 2:10172443-10172465 AACCGAGAGCTGAGGGAAGACGG + Intronic
926119900 2:10236218-10236240 AGGATGGAGAAGAGGGAAGAGGG - Intergenic
926127989 2:10283579-10283601 AGGTGAAAGGAGAGAGAAGGTGG - Intergenic
926355233 2:12035381-12035403 AGATGAGAGCTCAGAGAAGATGG + Intergenic
926380383 2:12281099-12281121 AGGTGAGCCCAGACTGAAGAAGG + Intergenic
926443193 2:12911463-12911485 AGGAGAGAGGAGAGGGGAGAAGG + Intergenic
926557465 2:14376167-14376189 GGGTGAGAACAAAGGGTAGATGG - Intergenic
926645993 2:15290075-15290097 GGGAGAGAGTAGAGGGGAGAGGG + Intronic
926646000 2:15290096-15290118 GGGAGAGAGGAGAGGGGAGAGGG + Intronic
926683205 2:15679632-15679654 AGATGAGAGCAAAGGAAAGGAGG - Intergenic
926726747 2:16004594-16004616 AGGTGGGGGCAGAGGGGATAGGG - Intergenic
926736572 2:16078013-16078035 AGGTGAAGGCAGGGAGAAGACGG + Intergenic
926800755 2:16658376-16658398 AGGTCAGGCCAGAAGGAAGATGG + Intronic
927019558 2:19002531-19002553 AGGAGAGAGCATTAGGAAGAAGG - Intergenic
927088127 2:19690395-19690417 AGGGGAGAGGAGAGAGGAGAGGG + Intergenic
927444011 2:23141915-23141937 AGGTGGGAGAATGGGGAAGAAGG + Intergenic
927630214 2:24766691-24766713 AGAAGAGAGGAGCGGGAAGAGGG + Intronic
927719674 2:25374552-25374574 AGTAGGAAGCAGAGGGAAGACGG + Intergenic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
927955812 2:27206648-27206670 ATTTGAGAGGAGAAGGAAGAGGG - Intronic
928224065 2:29432333-29432355 GGGAGAGAGCAATGGGAAGATGG - Intronic
928270364 2:29849805-29849827 AGGGGAGAGGAGAGGGGAGGAGG + Intronic
928285720 2:29988399-29988421 AGGGGAGAGGAAAGGGAGGAAGG + Intergenic
928559170 2:32461156-32461178 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
928559176 2:32461168-32461190 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
928704468 2:33933259-33933281 AGGTGAGAAAGAAGGGAAGAAGG - Intergenic
928712149 2:34019190-34019212 AGGTGAGAGCAGTGGCTTGAAGG - Intergenic
929905180 2:46039558-46039580 AGGGGAGAGGGAAGGGAAGAGGG + Intronic
929924969 2:46200481-46200503 TGCTGAGAGCAGAGGGCTGAGGG - Intergenic
930441288 2:51410125-51410147 AGGAGAGAGAAGAGTGCAGAGGG - Intergenic
930760317 2:55027809-55027831 CGGTGACAGCATAGGAAAGAAGG + Intronic
931133383 2:59366199-59366221 GGGGGAGAGAAGAAGGAAGAAGG + Intergenic
931153238 2:59598411-59598433 AGGAGAGAGCAGAGCAAAGGAGG + Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931785923 2:65619432-65619454 AGGTCAGAGCAAAGGTGAGATGG - Intergenic
931937239 2:67213215-67213237 TGGTAAGAGCAGACGGAAAATGG + Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932323195 2:70837039-70837061 AGGAAAGAGGAGAGGAAAGAGGG + Intergenic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932461294 2:71883547-71883569 AGGTGAAAACAGAGGGCATAAGG + Intergenic
933161408 2:79028039-79028061 AGATGAGAGGAGACGGGAGAAGG - Intronic
933226213 2:79752169-79752191 AGAGGAGAACAGAGGGATGAAGG + Intronic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933778676 2:85787050-85787072 GGGTGAGGGCGGAGGGGAGAGGG - Exonic
933807519 2:86011181-86011203 AGGTGACTGCCAAGGGAAGAAGG + Intergenic
933807716 2:86012189-86012211 TGGTGGGAGCACAGGGCAGAGGG - Intergenic
933808465 2:86017209-86017231 AGGGCAGACCAGAGGTAAGATGG + Intergenic
934171266 2:89542720-89542742 AGCACAGAGCAGAGGGCAGAGGG + Intergenic
934281572 2:91617038-91617060 AGCACAGAGCAGAGGGCAGAGGG + Intergenic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
934886565 2:98030529-98030551 AGGTGAGAGCAGAGGATGGAGGG - Intergenic
934998710 2:98989711-98989733 GGGAGAGAGGAGAGGGGAGAGGG + Intergenic
934998713 2:98989718-98989740 AGGAGAGGGGAGAGGGGAGAGGG + Intergenic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935423488 2:102894951-102894973 AGGTCAGACCAGATGGAAGTGGG + Intergenic
935648920 2:105365549-105365571 AGGGGAGAGAACAGGGAAGAGGG + Intronic
935867905 2:107411183-107411205 AGGAGCGAGGGGAGGGAAGAGGG - Intergenic
935974105 2:108560383-108560405 AGATGAGATCAGAGGGCAGCAGG - Intronic
936270240 2:111043507-111043529 AGGTGGGAGGAGAGGGCTGAGGG + Intronic
936464216 2:112732805-112732827 AGGGGAGAGCGGAGGTAACAGGG - Intronic
936490871 2:112971037-112971059 ATGTGAGAACAGAGAGAAGGCGG + Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
936617773 2:114066057-114066079 AGGAGAGAGCCCAAGGAAGAAGG - Intergenic
936870347 2:117129143-117129165 AGAAGAGAGAAGACGGAAGAGGG - Intergenic
936941473 2:117888742-117888764 AGGAGAGACAAGAGGAAAGAGGG + Intergenic
937015726 2:118603505-118603527 TGTTGAGGGCAGAGGGGAGAGGG + Intergenic
937159739 2:119748834-119748856 AGGTGAAAGGGGAGGGGAGAGGG - Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937466795 2:122139816-122139838 GGGCCAGAGAAGAGGGAAGAAGG + Intergenic
937832034 2:126434667-126434689 AGAGGAGAGGAGAGTGAAGAAGG + Intergenic
937940162 2:127278968-127278990 AGGTTAGAGCATAGAGAAAAGGG - Intronic
937979582 2:127607166-127607188 AGGTGAGATCAGGGGCAAGAAGG - Intronic
939369189 2:141276429-141276451 AGGTGGGAGGAGAGTCAAGATGG - Intronic
939507033 2:143057981-143058003 AGGTGACAGGAGAGAGAATAAGG + Intergenic
939606665 2:144262802-144262824 AGATGGGAGGAGAGGGGAGAGGG + Intronic
939606703 2:144262905-144262927 AGATGGGAGGAGAGGGGAGAGGG + Intronic
939606706 2:144262912-144262934 AGGAGAGGGGAGAGGGGAGAGGG + Intronic
939606708 2:144262919-144262941 GGGAGAGGGGAGAGGGAAGAGGG + Intronic
940185562 2:150981146-150981168 AGGGGAGGTAAGAGGGAAGATGG - Intergenic
940220645 2:151347871-151347893 AAGTGAGTGCCGAGGGAAGGAGG + Intergenic
940420043 2:153470326-153470348 TGGTGAGAGGAGAGAGAACATGG - Intergenic
940904101 2:159153378-159153400 AGGTGAAAGCAGAAGGAATTAGG + Intronic
940985907 2:160052137-160052159 AGGTGAGATTAGAGAGAAAATGG - Intronic
941045340 2:160669325-160669347 AGCTGAGGGCAGGGGGAATAAGG - Intergenic
941275276 2:163483170-163483192 AAGTGAGAGCAAAGTGATGAAGG + Intergenic
941463654 2:165800212-165800234 AGGTGAGGGCCAAGGGAGGAAGG - Intergenic
941577829 2:167257147-167257169 TGGTGATAGCAGAGGGAGCAAGG - Intronic
941624432 2:167815130-167815152 ATGTGAGAGGAGAAAGAAGAAGG - Intergenic
941687475 2:168461914-168461936 AGGTGGCAGCAGAGGGAAAATGG + Intronic
941729215 2:168897290-168897312 AGAAGAGAGTAGAGGGAACAGGG - Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
942468895 2:176239091-176239113 AGGTGGGAGCAAAGGGAAAATGG - Intergenic
942543022 2:177034456-177034478 AGATGAGGGAAGAGAGAAGACGG + Intergenic
942617628 2:177810550-177810572 AGGTTAGAGCAGAGATCAGATGG + Intronic
942899401 2:181096072-181096094 AGGAGAGAGGAGAAGGGAGAGGG - Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943218293 2:185068561-185068583 AGGTGAGAGTGAAGGGAAAATGG + Intergenic
943739055 2:191391157-191391179 TGGTGAGGGCAGAAGGAATAAGG - Intronic
944280436 2:197890095-197890117 AGGTGAGAGAAGAGCCAACAGGG + Intronic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944732642 2:202533186-202533208 AGGTGAGAGAAGAGGAAGGAAGG - Intronic
944865185 2:203852861-203852883 AAGAGAGAGAGGAGGGAAGAGGG - Intergenic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945194714 2:207227380-207227402 AGGTGGGGGGAGGGGGAAGATGG + Intergenic
945225361 2:207528125-207528147 ACATAAGACCAGAGGGAAGAGGG + Intergenic
945968149 2:216210104-216210126 AGAGGAAAGCAGAAGGAAGATGG + Intergenic
946040181 2:216776290-216776312 AGTTGACAGCGGAGGGAGGAAGG + Intergenic
946051066 2:216863072-216863094 AGCTGAGATCACAGGGAAGAAGG + Intergenic
946109622 2:217403183-217403205 AGGTGGGAGGAGAAGGGAGAGGG + Intronic
946396302 2:219445344-219445366 AGGTGGGAGCAGGGGGATGTGGG - Intronic
946498746 2:220222794-220222816 AGGTGTGAGAAAAGGGTAGAAGG - Intergenic
946715529 2:222551287-222551309 ATGTGAGGCCAGAGGGAAAACGG - Intronic
946869090 2:224069876-224069898 TGGTGAGTGCTGAGGGAATATGG - Intergenic
946965377 2:225031531-225031553 AGGTGTGAGCAGGGAGAAGGAGG + Intronic
947007460 2:225528722-225528744 AGGTGAAAGCACTGGGAAGTGGG - Intronic
947335148 2:229074404-229074426 AGGGAAGAAGAGAGGGAAGAAGG + Intronic
947551768 2:231051451-231051473 ATGGGAGGTCAGAGGGAAGAAGG + Intergenic
947906700 2:233769579-233769601 AGATGAGAGGAGACGGAACACGG + Intronic
947935780 2:234002218-234002240 AGGAGTGGGCAGAGGGAGGAGGG + Intronic
947978154 2:234385483-234385505 AGATGCGTGCAGAGGGAAGATGG - Intergenic
948006886 2:234617052-234617074 AGGTGATAGAAGAGAGAAGTGGG + Intergenic
948241508 2:236440733-236440755 AGATGAGGGGAGAGGGAAGCTGG + Intronic
948265665 2:236633531-236633553 AGGTGAGAGATGTGGAAAGAGGG + Intergenic
948322437 2:237081489-237081511 AGGTGAGAGAAGAGCAAAGGAGG - Intergenic
948533632 2:238630215-238630237 ACGTGAGAGCAGCAGGAAGTTGG + Intergenic
948568239 2:238899872-238899894 GGGTGGGAGCAGAGGGTATATGG + Intronic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948676270 2:239598665-239598687 AGGTGAGAACACTGGGAAGGAGG - Intergenic
948920494 2:241063934-241063956 AGGAGAGGACAGCGGGAAGAAGG - Intronic
948924146 2:241083101-241083123 TGGTGAGTGCAAAGGGAAAAAGG + Intronic
1168892019 20:1300818-1300840 AGGAGAGAGCAGACGGATGCTGG - Intronic
1169054850 20:2612072-2612094 AGGGGAGAGCAGAAGCTAGATGG + Intronic
1169254041 20:4083711-4083733 ATCTGAAAGCAGAGAGAAGAAGG - Intergenic
1169469472 20:5871723-5871745 AGGGGAGGGAAGGGGGAAGAAGG + Intergenic
1169550833 20:6699595-6699617 AGGGGAGAGAGGAAGGAAGATGG - Intergenic
1169674408 20:8137281-8137303 ATGAGAGAGCAGAGGGGAAAAGG + Intronic
1169899135 20:10535118-10535140 AGGAGAGAGACCAGGGAAGACGG + Intronic
1169938977 20:10916598-10916620 TGGTGAATGCAGAAGGAAGAAGG - Intergenic
1170212640 20:13860657-13860679 AGGTGAGAGAAGAGAAAAGAGGG - Intronic
1170441741 20:16386291-16386313 TGGAAAGGGCAGAGGGAAGAGGG + Intronic
1170484591 20:16803687-16803709 AGATGAGAGCCAAGGGAGGATGG - Intergenic
1170582408 20:17709376-17709398 ATGTGAGAGCAGAGGAATGAAGG + Intronic
1170701814 20:18710869-18710891 AGGAGAGAACACAGGGAAAACGG - Intronic
1170819224 20:19742067-19742089 AGGAGAGAGCACAGAGAAGCTGG - Intergenic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1171868152 20:30505616-30505638 AGGGGGGAGCAGGGGGAGGAAGG - Intergenic
1171905053 20:30893704-30893726 AGGAGAGAACAGAGGGAAGGAGG - Intergenic
1172184614 20:33023588-33023610 AGGGGGGAGATGAGGGAAGAGGG - Exonic
1172581734 20:36053675-36053697 ACCTGAGAGAAGAGGGAGGAGGG + Intergenic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172718698 20:36983115-36983137 AAGAGAGAGCAGAGGAGAGAAGG - Intergenic
1172789211 20:37490953-37490975 TGGAGAGTGTAGAGGGAAGATGG - Intergenic
1172813609 20:37669449-37669471 AGGTGAGAAGACAGGGAAAAAGG - Intergenic
1172872264 20:38143139-38143161 AGGAGAGAGGAGAGGAAAGAGGG + Intronic
1172941591 20:38658159-38658181 AGGGGAGGGGAGAGGGAACAAGG - Intergenic
1173089354 20:39955518-39955540 TGGGGAGAGCAGAGTGAACAAGG - Intergenic
1173334947 20:42105002-42105024 AGGTGAAAGCTGAGGGGACATGG - Intronic
1173759275 20:45545587-45545609 AGGTGAGGACAGGGGGAGGAGGG + Intronic
1173997846 20:47353070-47353092 AGGAGAGAGAAGGGGAAAGAGGG + Intronic
1174020832 20:47526783-47526805 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1174193416 20:48756273-48756295 AGGTGGGAACAGAGTGGAGAGGG - Intronic
1174504054 20:51005267-51005289 AGGTGGGAGCAGTGGGCAGTGGG - Intronic
1174595410 20:51679562-51679584 AGGTGACAGCAGGGGAAGGAGGG - Intronic
1176074586 20:63242753-63242775 ACATGACAGCAGAGGGAACATGG + Intronic
1176142257 20:63549936-63549958 AGGTGCAAGGAGGGGGAAGATGG - Intronic
1176148847 20:63578723-63578745 AGGTGATGGCAGACGGCAGAGGG - Intergenic
1176949946 21:15032717-15032739 AGGGGAGAGCAGAAGGAAGCAGG - Intronic
1177449920 21:21253031-21253053 AGATCAGAGAAAAGGGAAGATGG - Intronic
1177529247 21:22339004-22339026 AGGAGAGAGAAGAGGGTAAAGGG - Intergenic
1177558216 21:22718144-22718166 TGGTAAGAGCAGGGGCAAGAGGG + Intergenic
1177636913 21:23799165-23799187 ATCTGAGAGCAAAAGGAAGAGGG + Intergenic
1178025277 21:28459305-28459327 GGGTGAGAGCTGATGGAATAGGG - Intergenic
1178443354 21:32616503-32616525 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1178599492 21:33983801-33983823 ATGTAAGAGGAGAGGGAACAGGG - Intergenic
1178785404 21:35648842-35648864 AAGTGAGATCAGAGGGAGAATGG - Intronic
1178797686 21:35760143-35760165 TGGCCAGAGCAGAAGGAAGAAGG - Intronic
1178867462 21:36341465-36341487 AGATGAGATAACAGGGAAGAAGG + Exonic
1179008641 21:37535848-37535870 AGGTTTGCGCAGAGGGCAGATGG + Intergenic
1179521131 21:41945767-41945789 AGGCGGCAGGAGAGGGAAGAAGG - Intronic
1179555285 21:42171343-42171365 AGGTGAGGACAGAGGGGAGGAGG - Intergenic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1179714762 21:43280940-43280962 AGGTGGGGGCAGAGGGGAGGTGG + Intergenic
1179731326 21:43369370-43369392 AGATGAGAGCTGAGAGCAGAAGG + Intergenic
1179919049 21:44497445-44497467 AGGAGAGGGCAGGGGGAAGGGGG - Intergenic
1180136715 21:45866772-45866794 AGGGGAGAGGAGAGGGGAGGGGG - Intronic
1180259192 21:46656176-46656198 GGGTGGGAGCAGAGGCAAGTGGG - Intronic
1180316845 22:11283630-11283652 AGGAGAGAACAGAGGGAGGGAGG + Intergenic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1180844311 22:18973063-18973085 AGGTGAGTGGAGAGGGGACAGGG + Intergenic
1181052987 22:20246456-20246478 AGGTGGGAGGAGAGCGAGGAGGG + Intronic
1181057160 22:20265648-20265670 AGGTGAGTGGAGAGGGGACAGGG - Intronic
1181094525 22:20496236-20496258 AGGAGAGAAGAGAGTGAAGAAGG - Intronic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181463050 22:23096571-23096593 AGGTGGGGGCAGAGGGAACAGGG + Intronic
1181530152 22:23512815-23512837 AGGTGGGGTCAGAGGGCAGATGG + Intergenic
1181533927 22:23532167-23532189 AGGAGAGAGGAGAGGGGAGGAGG + Intergenic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1182013551 22:27020511-27020533 AGGTGAGGGGAAAGGAAAGAAGG + Intergenic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183104177 22:35604364-35604386 AGGTGAGAGCAAAAGGAATAAGG - Intergenic
1183248836 22:36713911-36713933 AGGTGAGGACCCAGGGAAGAGGG - Intergenic
1183712144 22:39511306-39511328 TGGTGAGCGCAAAGGCAAGAAGG + Exonic
1183730461 22:39615612-39615634 TGGGGAGAGAGGAGGGAAGAGGG - Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183933199 22:41247826-41247848 GGCTGGGAGCTGAGGGAAGAGGG + Intronic
1184067663 22:42129566-42129588 AGGTGTGAGCATGGGGACGAGGG - Intronic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184278948 22:43426374-43426396 AGGTGACAGCACAGGGAGGGGGG + Intronic
1184320343 22:43737058-43737080 AGGAGAGGGCAGAGGGGAGGAGG - Intronic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184509368 22:44924098-44924120 AGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184552746 22:45213273-45213295 GGCTGAGGGCAGAGGGCAGAGGG - Intronic
1184596049 22:45514889-45514911 GGGTGAGAGCAGTGGGCAGGAGG + Intronic
1184644447 22:45888668-45888690 TGGTGAGAGCCGAGGGCAGGGGG - Intergenic
1184859200 22:47163606-47163628 AGGAGAGGGCAGAGGGTAGGAGG + Intronic
1184874050 22:47261514-47261536 GGGTCAGAGAGGAGGGAAGATGG - Intergenic
1184924999 22:47630510-47630532 AGGTGAGACCAGAAGGCAGAGGG - Intergenic
1184955981 22:47886207-47886229 AGATGGGAGCAGAGAGAGGAGGG + Intergenic
1184959356 22:47917867-47917889 AGGAGGAAGGAGAGGGAAGAAGG - Intergenic
1185251272 22:49802815-49802837 AGGTGAGGACAGAGGAGAGATGG + Intronic
1185293268 22:50039397-50039419 AGAAGAGAGAACAGGGAAGAAGG + Intronic
1185394481 22:50579678-50579700 AGGGCAGAGCAGAGGAAAGAGGG - Intronic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949256172 3:2049004-2049026 AGATGAGAGCAAAGAGAAGCTGG - Intergenic
949494559 3:4619617-4619639 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494563 3:4619637-4619659 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494567 3:4619657-4619679 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494571 3:4619677-4619699 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494575 3:4619697-4619719 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949494579 3:4619717-4619739 AGGGGAGAGCAGAGGAGAGCAGG - Intronic
949538467 3:5013673-5013695 AGCTGAGAGTGGGGGGAAGAAGG - Intergenic
949887850 3:8710603-8710625 AGTAGAGAGCACAGGAAAGATGG + Intronic
950149558 3:10676175-10676197 AGGAGAGAGAAAAGGGAGGAAGG + Intronic
950401605 3:12773273-12773295 AGAGGAGGGGAGAGGGAAGAAGG + Intergenic
950431345 3:12952854-12952876 AGGTGGCAGAAGAGGGATGAGGG + Intronic
950755092 3:15164178-15164200 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
951330632 3:21364279-21364301 AGGTGACAGGAAAGAGAAGAGGG - Intergenic
951360123 3:21715226-21715248 GGGTGAGAGGAGAGGGAATGAGG - Intronic
951524840 3:23643944-23643966 AGGTGAGAGAAGAGGGAATACGG - Intergenic
952035436 3:29195710-29195732 AGAACAAAGCAGAGGGAAGAAGG - Intergenic
952364529 3:32663441-32663463 GGGAGAGGGAAGAGGGAAGAGGG - Intergenic
952388473 3:32860131-32860153 AGGGGAGAGGGGAGGGAAGAGGG - Intronic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952712974 3:36450404-36450426 AGATGACAGATGAGGGAAGAGGG - Intronic
952829947 3:37556288-37556310 AGGGTAGAGCAGAAGGAAAAAGG - Intronic
952873785 3:37924997-37925019 AGGTGAGACCAGAGTGGGGAAGG - Intronic
952970009 3:38644848-38644870 GGGTTGGAGCAGAGGGAATAGGG - Intronic
953133352 3:40161764-40161786 AGGTGAGTGTAGAGTGAGGAAGG - Intronic
953197982 3:40751982-40752004 GGGAGAGATCAGAGGGAAGTGGG + Intergenic
953375484 3:42424647-42424669 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
954117497 3:48475361-48475383 AGGAGGGAGCAGAAGGCAGAGGG + Intronic
954367833 3:50155563-50155585 AGGTGAGTGCAGCGGGAACCGGG + Exonic
954396560 3:50296354-50296376 AGGTGAGAGGTGAGGGTAGGGGG + Intronic
954634390 3:52063696-52063718 AGGCGAGAGCTGGGAGAAGAGGG - Intergenic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955122553 3:56075303-56075325 ATGTGAGGGCAGAGGAAAGAGGG + Intronic
955144370 3:56301493-56301515 GGGGGAGAGAAGAGGGGAGAGGG - Intronic
955198816 3:56830905-56830927 AGATGAGATCAGAAGAAAGATGG - Intronic
955592346 3:60551484-60551506 AGGGGAGAGGGGAGGGGAGACGG + Intronic
955716946 3:61839799-61839821 AGTTGAGAGGTGAGGGAAGCAGG - Intronic
955793663 3:62613098-62613120 AGCTGAGACCAGATGGAGGAGGG + Intronic
955874802 3:63477457-63477479 AGCTGAGGGCAGAGGGGAGTGGG + Intronic
955936033 3:64103503-64103525 AGGTCAGGGCAGTGGGAGGAGGG + Intronic
956139742 3:66133781-66133803 AGTTGAAAGCAGAGAGAAGGCGG + Exonic
956637305 3:71379071-71379093 TAATGAGGGCAGAGGGAAGAAGG - Intronic
956693108 3:71895832-71895854 AACTGAGAGTAGAGAGAAGATGG + Intergenic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
956870384 3:73411454-73411476 AGGTGTGAGCAAAGGCAAGGTGG + Intronic
957374174 3:79335502-79335524 AAGTGAGAGCTGAGTGAAGGGGG - Intronic
957434507 3:80156399-80156421 AAGTAAGAGCAGAGCAAAGAAGG - Intergenic
957683462 3:83469854-83469876 AGGGGAGAGGAGGGGGAAGATGG + Intergenic
957894429 3:86403099-86403121 AGGGGAGAGAAGAGACAAGAGGG - Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958535679 3:95399729-95399751 AGGGGAGAGCAGGGGAAAGGCGG + Intergenic
959167097 3:102793948-102793970 AGGGGAGGGGAGAGGGGAGAGGG + Intergenic
959434774 3:106301020-106301042 AGGAGAGAAAAGAGGGAGGAGGG - Intergenic
959468609 3:106721013-106721035 GGGTGCCAGCAGAGGGCAGAGGG + Intergenic
959683592 3:109123331-109123353 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
960885052 3:122384691-122384713 AGGAAGGAGCAGGGGGAAGAGGG - Intronic
960961798 3:123076036-123076058 TGCTGGTAGCAGAGGGAAGATGG + Intronic
960991444 3:123314181-123314203 GGCTGAGAGAAGCGGGAAGAAGG + Intronic
961134084 3:124494169-124494191 AGGTGGGAGCAGAGAAAAGGTGG - Intronic
961141843 3:124562727-124562749 GTGTGAGAGCAGAGGTAAGGAGG - Intronic
961173559 3:124816099-124816121 AGATGGGAGCAGTGGGAAGGGGG + Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961276154 3:125728657-125728679 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
961379475 3:126487710-126487732 AGCTGGGAGCCGAGGGGAGAGGG + Intronic
961659920 3:128463258-128463280 GGGTGAGAGGAGAGGGAACGTGG + Exonic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
961875335 3:130018383-130018405 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
961916296 3:130378594-130378616 AGATGAGGCCAGAGGGAAGCAGG - Intronic
962039704 3:131693733-131693755 AGGTAAGAGGGGAGGTAAGAGGG - Intronic
962202719 3:133414442-133414464 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962202753 3:133414562-133414584 AGTAGAGAGGAGAGGGGAGAGGG - Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962202833 3:133414916-133414938 AGGGGTGAGCAGAGGGGACAGGG - Intronic
962202843 3:133414951-133414973 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962202929 3:133415293-133415315 AGGGGCGAGTAGAGGGGAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203170 3:133416244-133416266 AGGAGAGAGGACAGGGGAGAGGG - Intronic
962203201 3:133416374-133416396 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203209 3:133416398-133416420 AGGGGAGAGTAGAGGGGAAAGGG - Intronic
962203255 3:133416605-133416627 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962203375 3:133417090-133417112 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962203478 3:133417468-133417490 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203510 3:133417585-133417607 AGGAGTGAGTAGAGGGGAGATGG - Intronic
962205749 3:133432405-133432427 AGGTGAAAGCAGAGAGAGGCTGG - Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
962844796 3:139264745-139264767 AGGTAAGTGGAGAGGGAAGCAGG - Intronic
963248171 3:143082119-143082141 AGGAGAGGGAAGAAGGAAGAAGG - Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963671475 3:148257504-148257526 AGGAAAGTGCAGAGTGAAGAGGG - Intergenic
964148684 3:153497756-153497778 AGCTGAGGGGAGAGGGAGGAGGG - Intronic
965018079 3:163186738-163186760 AGGAGAGAGAAGAGTGAAGGGGG + Intergenic
965179476 3:165383574-165383596 AAGTGAAAGCAGGGGGAAGCAGG + Intergenic
965370878 3:167861035-167861057 AGGTGGGAGGAGAGGGATAAAGG - Intergenic
965607647 3:170512561-170512583 AGGGGAGAGGAGAAGGAAGGAGG - Intronic
965743049 3:171896937-171896959 AGGTGAGAGGAGAGGTCACAGGG + Intronic
966188518 3:177249442-177249464 AGGTGTGAGCAGAAGCAACACGG - Intergenic
966286792 3:178306617-178306639 AGGGGAGAGAAGGGGGTAGAGGG - Intergenic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
966365716 3:179185360-179185382 GTGTGAGAGCAGAGGAAAAATGG - Intronic
966457286 3:180131919-180131941 TGGTGATGGCAGAGGGAAGAAGG + Intergenic
967195520 3:187022305-187022327 GTGTGAGAGCAGAGGAAAGATGG + Intronic
967249570 3:187523028-187523050 GGGAGAGAGGAGAGGAAAGAAGG - Intergenic
967674032 3:192274568-192274590 AAGAGAGAGGAGAGAGAAGAGGG + Intronic
968350636 3:198049226-198049248 AGGTGGGGGCATAGGGAAAATGG - Intergenic
968426219 4:525138-525160 AGGAGAGAGAAAAGGGAGGATGG - Intronic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968937225 4:3617573-3617595 AGGAGGGAGGGGAGGGAAGAAGG - Intergenic
968990136 4:3905240-3905262 AGGAGAGTGCAGTGGGCAGATGG - Intergenic
969028506 4:4193168-4193190 AGCACAGAGCAGAGGGCAGAGGG - Intronic
969156608 4:5216615-5216637 AGGACACTGCAGAGGGAAGATGG + Intronic
969212603 4:5699195-5699217 AGGTGTGGGAAGAGGGAAAATGG + Intronic
969243428 4:5916874-5916896 AGCTGAGAGCAGAGGCAGGCTGG + Intronic
969307737 4:6335463-6335485 AGGAGTGAGCAGGGGGAACAGGG + Intronic
969451652 4:7277232-7277254 AGGTGAAGGCAGAGGAAAGAAGG + Intronic
969700250 4:8764061-8764083 AGGTGGAAGCTGAGGCAAGAGGG + Intergenic
969735349 4:8985569-8985591 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
969762792 4:9201792-9201814 ATGGGAGAGCAGATGGCAGAAGG + Intergenic
969786654 4:9463400-9463422 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
970016601 4:11519189-11519211 GGGTGAGAGCAGAGACAATAGGG - Intergenic
970145970 4:13036100-13036122 AGGTGAGAGAAGAAGGAAAGAGG - Intergenic
970321169 4:14877042-14877064 AGCTTAGACCAGAGGCAAGAGGG + Intergenic
970397362 4:15682020-15682042 AGGTGAGAGCAGAAGCAATCCGG + Intronic
970963301 4:21898397-21898419 AGGTGAGGGGAGAGTAAAGAGGG + Intronic
971165935 4:24183680-24183702 AGGAAAGAGCAGAGTGAGGAAGG - Intergenic
971309741 4:25515051-25515073 GGAGGAGAGCAGAGGGAAGCGGG + Intergenic
971313537 4:25547442-25547464 AGGAGAGAGGAGAGGAAACATGG - Intergenic
971412102 4:26384937-26384959 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
971412108 4:26384949-26384971 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
971412114 4:26384961-26384983 AGGAGAGAGGGGAGGGGAGAGGG - Intronic
971943724 4:33247043-33247065 AGGTGACAGGAGAGAGAAGGAGG + Intergenic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
972644415 4:40954132-40954154 AGGTGAGCCTAGGGGGAAGAGGG - Intronic
972706980 4:41554401-41554423 AGGTGACAGCAGAAGGAATTGGG - Intronic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
972770620 4:42193877-42193899 TGGGTAAAGCAGAGGGAAGATGG + Intergenic
973334637 4:48943565-48943587 AGGTGAGAGCAGACAGCAGAGGG + Intergenic
973335698 4:48954336-48954358 AGGAGAGAGGAGAGGACAGAAGG - Intergenic
973562175 4:52148354-52148376 AGGAGAGAAGAGAGGGAAGATGG + Intergenic
973808432 4:54547626-54547648 AGGTGGAAGCAGAAGGCAGAAGG - Intergenic
973862106 4:55076206-55076228 AGGTGAGAGCTGTGGGGAGGGGG - Intergenic
973979076 4:56291648-56291670 TGGTGAGAGCAGGAGAAAGAGGG - Intronic
974074294 4:57154827-57154849 AGGAAAGAGAAGAGGGGAGAAGG - Intergenic
974075806 4:57167185-57167207 AGGTGAGAGCAGGGGGTTGCAGG + Intergenic
974091952 4:57320934-57320956 AGGAGAAAGCAGAGGAAGGAAGG - Intergenic
974836024 4:67252197-67252219 TGTTGAGAGCAAAGGGAAAATGG - Intergenic
974867235 4:67596221-67596243 AAGAGAGAGCACAGGGAAAATGG - Intronic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
976099989 4:81551097-81551119 AGGAAGGAGCAGAGGGAAAATGG + Intronic
976403702 4:84637433-84637455 TGGTCAGAGCAGGAGGAAGAGGG + Intronic
976478329 4:85510572-85510594 GGGAGAGAGGGGAGGGAAGAAGG - Intronic
976613943 4:87057243-87057265 AGAGGAGAGCAGTGGGGAGATGG + Intronic
976615239 4:87069500-87069522 AGGGGAGAGGAGAGAAAAGATGG - Intronic
976953590 4:90865976-90865998 TGGTCAGAGCAGGAGGAAGAGGG + Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978739249 4:112119036-112119058 AGAGGAGAGGGGAGGGAAGAGGG + Intergenic
978739260 4:112119065-112119087 AGGGGAGAGGAGAGGGGAGAGGG + Intergenic
979362855 4:119784637-119784659 TGGTGACAGGAGAGGGAAGCAGG + Intergenic
980041715 4:127947679-127947701 AGGGGAGAGCAAAAGAAAGATGG + Intronic
980084320 4:128376357-128376379 AGGAGAGAGAAGAGTGAAGGAGG + Intergenic
980084593 4:128378226-128378248 AGGTGGCAGGAGAGAGAAGAGGG + Intergenic
980084594 4:128378233-128378255 AGGAGAGAGAAGAGGGAAGAAGG + Intergenic
980253808 4:130350339-130350361 AGGAGAAAACAGAGGAAAGAGGG - Intergenic
980563007 4:134502003-134502025 AGGTGGGGGCAGGGGGAAGGGGG - Intergenic
980737542 4:136911003-136911025 AGGGGAGAGGAGAGGGAGGTGGG - Intergenic
980896941 4:138869004-138869026 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
981140184 4:141259097-141259119 AGGAGAGAGGAGAGTAAAGAGGG + Intergenic
981616897 4:146651836-146651858 AGATGAGAGGAGAGAAAAGAGGG - Intergenic
981653059 4:147080633-147080655 ATGAGAGTGCACAGGGAAGAGGG - Intergenic
981931404 4:150192756-150192778 AGTTGTTAGGAGAGGGAAGAAGG + Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982481009 4:155909921-155909943 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
983495782 4:168441019-168441041 AGATGAGAGGAGGGGGAGGATGG + Intronic
983631455 4:169853486-169853508 TGGTCAGAGCAGGAGGAAGAGGG - Intergenic
983710077 4:170704044-170704066 ACCTGAGAGCAGAGGGTAGGAGG - Intergenic
984067698 4:175069659-175069681 AGGTCAAAACACAGGGAAGAAGG - Intergenic
984100696 4:175481985-175482007 ATGTGAAAACAGAGGAAAGATGG - Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984844845 4:184100525-184100547 AGGTGAGAAAAAAGGGTAGAGGG + Intronic
984918417 4:184743482-184743504 AGGGGAGGGCAGAGGGAAGAGGG + Intergenic
984958528 4:185070882-185070904 AGGGGAAAGGAAAGGGAAGAGGG - Intergenic
984998937 4:185465890-185465912 TGGTGAGAGCAGATGGATGAGGG + Intronic
985311788 4:188609526-188609548 AGCTGAGCTCAGATGGAAGAGGG + Intergenic
985487117 5:158158-158180 AGGATAGAGCAGAGGGAGGAGGG - Intronic
985658074 5:1142343-1142365 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
986065384 5:4229612-4229634 AGGTCAGAGCAGAAGGAGGTGGG - Intergenic
986152430 5:5140107-5140129 AGCGGGGAGCAGAGGGAAGGCGG - Intergenic
986412491 5:7494392-7494414 AGTTGAGAGCAGAGAGAGAAGGG - Intronic
986434938 5:7720162-7720184 AGGGGAGAGAAGAGGAGAGAAGG - Intronic
986601042 5:9473593-9473615 AGGAGAGAGAGGAGGAAAGAAGG + Intronic
986627489 5:9736329-9736351 TGGTAAGTGCAGAGGGAATAAGG - Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986995668 5:13604443-13604465 AGGAGAGAGAAGAGCAAAGAAGG - Intergenic
987071251 5:14338805-14338827 AGGAAGGGGCAGAGGGAAGAGGG + Intronic
987080213 5:14419196-14419218 ATCTGAGGGCAGAGGGCAGAGGG + Intronic
987096199 5:14552597-14552619 ACGTGAGGACACAGGGAAGATGG + Intergenic
987192564 5:15493258-15493280 TGGTCAGAACAGAAGGAAGAGGG - Intergenic
987299624 5:16585806-16585828 TGGTGGGAGCAGTGGCAAGAGGG + Intronic
988018742 5:25596286-25596308 AGGGGTGAGCTGAGAGAAGATGG + Intergenic
988959333 5:36353923-36353945 AAAAGAGAGCAGAGGGCAGAAGG + Intergenic
989199882 5:38752589-38752611 ATGTGAGAGCAGAAGGGAAAAGG - Intergenic
989401995 5:41017736-41017758 AGGAGAGAGGAGAGGGGAGGAGG + Intronic
989608833 5:43272433-43272455 GGCTGAGAGCAGAATGAAGAAGG - Intronic
989634679 5:43521480-43521502 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
989778289 5:45234643-45234665 AGGTGAGAGGAGGGTGAGGATGG - Intergenic
990271902 5:54151135-54151157 AGGGGAGAGAAAAGGGAATAAGG + Intronic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
990943871 5:61230152-61230174 GGGTGAGAGGAGAGGGGAGAGGG - Intergenic
991184728 5:63794042-63794064 AGGAGAGAGAAGAGTGAAGGAGG + Intergenic
991571283 5:68055893-68055915 AGGTGAGACAAGGGGTAAGATGG - Intergenic
991645385 5:68795814-68795836 AGGTGGGAGGTGAGGGAAGGTGG - Intergenic
991980426 5:72224789-72224811 AAGTGAAAGTAGAGGGGAGAGGG - Intronic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992605087 5:78447894-78447916 AGGAGGGAGAAGAGGGAGGAGGG - Intronic
992939883 5:81751303-81751325 AGGAGAGCGGAGAGGGAAGGCGG - Intronic
993374628 5:87135646-87135668 AGGGGAGAGGGGAGGGAGGAGGG + Intergenic
993425606 5:87760649-87760671 AGGTGAGAGAGGAGGAAAGGAGG - Intergenic
993432449 5:87848659-87848681 AGGTGAGAGAAGAAGGCAGGTGG - Intergenic
993986401 5:94602631-94602653 AGATGAGAGCCAAGTGAAGAGGG - Intronic
993998988 5:94755480-94755502 TGGTGAGAGCAGAACGCAGAAGG - Intronic
994002668 5:94799137-94799159 AGGAGATAGAAGAGAGAAGAAGG + Intronic
994130714 5:96224518-96224540 AGGAGAGAGCAATGTGAAGATGG + Intergenic
994439540 5:99784931-99784953 GTGTGAGAGCAGAGGAAACATGG - Intergenic
994459587 5:100054922-100054944 AGATGCGAGCAGAAGGAAGGAGG + Intergenic
994910538 5:105899783-105899805 AGATGGGAGTAGAGTGAAGAAGG - Intergenic
994918992 5:106017717-106017739 AGGGAAGAGAAGAGGGAAGGAGG - Intergenic
994943762 5:106359072-106359094 AGGTGAGATGAGCGGGAAGAGGG + Intergenic
995050356 5:107696488-107696510 TGGAGAGAGAAGAGGGAAGAAGG + Intergenic
995106199 5:108380893-108380915 AGGTGGGAGAAGAGGGCGGAGGG + Exonic
995157221 5:108930346-108930368 AGGGGAGAGGAGAGGGGAGGCGG - Intronic
995369053 5:111398097-111398119 GGAAGAGAGCAGAGGGAAGCAGG - Intronic
995851136 5:116546835-116546857 AAGTGAGAGGAGAGGGAATCAGG - Intronic
995855140 5:116584006-116584028 AGGTCTGAGCAGACGGAAGGAGG - Intergenic
996001476 5:118369239-118369261 AGGAGAGAGGAGAAGGCAGAAGG - Intergenic
996075221 5:119185102-119185124 AGGTGAAAGCAGAGGAAAGAAGG - Intronic
996102738 5:119461017-119461039 AAGTGAGAGATGAGGGCAGAGGG + Intronic
996403931 5:123089024-123089046 AGGGGAGGGGAGAGGGAAGAAGG - Intergenic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
996798354 5:127375620-127375642 AGGGAAGAGGGGAGGGAAGAAGG - Intronic
996821978 5:127639608-127639630 AAGAGAGAGGAGAGGGAAGAAGG - Intergenic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
997616253 5:135248149-135248171 AGGGGAGAGGAGAGGAAAGTGGG - Intronic
997709395 5:135990959-135990981 AGTGGAGAGCAGTGGGCAGATGG + Intergenic
998140894 5:139698822-139698844 AGCTGGGAGCAGAGGGAGCAGGG - Intergenic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998426578 5:142033935-142033957 AGGTGAGAGGGGAAGGAAGGAGG + Intergenic
998472886 5:142397036-142397058 AGGTGAGGGCATAGGGGAGAAGG + Intergenic
998503678 5:142654879-142654901 AGGGGAGAGCAGAGGGCTGCAGG + Intronic
998990797 5:147813835-147813857 AGGGGAGAAGAGAGAGAAGAAGG - Intergenic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999113510 5:149141863-149141885 AGGTGAGAGCAAGGAGAAGGAGG - Exonic
999720577 5:154396379-154396401 AGGTGGGAGCAGGTGGCAGAGGG + Intronic
1000185132 5:158851549-158851571 AGGAGAGAGGGGAGGGAAAAAGG + Intronic
1000360712 5:160444125-160444147 AGATGGGAGCTGAGGAAAGAGGG + Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001136844 5:169109688-169109710 AGATGAGAGCAGAGTGAAATAGG - Intronic
1001141519 5:169147905-169147927 AGGAGGGGGCAGAGAGAAGACGG - Intronic
1001314558 5:170633079-170633101 GGGGGAGAGCAGAGGGAAGGGGG + Intronic
1001380617 5:171304255-171304277 AGGTTAGAGGAGAGGGAAGCAGG - Intergenic
1001506576 5:172284292-172284314 AGAAGAAAGGAGAGGGAAGAAGG + Intergenic
1001848740 5:174944145-174944167 AGGTGAGAACAGAAAGAAGAGGG + Intergenic
1001946902 5:175786754-175786776 AGGCAAGAACAGAGGGAAGGAGG - Intergenic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002060143 5:176621052-176621074 AGGTGGGAGCAGGGAGGAGAGGG - Intronic
1002224045 5:177705340-177705362 TGGTGAAACCAGAAGGAAGAGGG - Intergenic
1002985069 6:2181773-2181795 AGGCCTGAGGAGAGGGAAGAGGG - Intronic
1003379775 6:5613917-5613939 AGCTGAGAACAGAAGGATGATGG + Intronic
1003945306 6:11070127-11070149 ATGAGAGAGCAGAGGAAAGGGGG + Intergenic
1004026339 6:11823006-11823028 AGGTGAGACAAGATGGAAGGAGG - Intergenic
1004273070 6:14212030-14212052 AGGTGGGAGCAGGGAGTAGAGGG - Intergenic
1004286172 6:14322806-14322828 AGGGGACTCCAGAGGGAAGAGGG + Intergenic
1004589311 6:17033219-17033241 AGGTGGGAGCATGGGAAAGACGG - Intergenic
1004653066 6:17630718-17630740 AGGGGAGACAAGAGGGGAGAGGG + Intronic
1004653071 6:17630730-17630752 AGGGGAGAGGGGAGGGGAGAAGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004984989 6:21071328-21071350 AGGAGAGAGGAGAGTCAAGAGGG - Intronic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1005794244 6:29340838-29340860 AGGAGAGAGAAGAGTGAAGGAGG - Intergenic
1006266649 6:32931345-32931367 GCCTAAGAGCAGAGGGAAGAGGG + Intergenic
1006388863 6:33747060-33747082 AGGAGAGAGAAGAGGGGAGGAGG + Intergenic
1006442100 6:34059284-34059306 AGGTGAGGGCAGCGGGTAGGGGG - Intronic
1006699752 6:35962477-35962499 AGGGGAGGGCAGAGGGAGGTTGG - Intronic
1006814147 6:36839496-36839518 AGGAGAGAGGAGCGCGAAGAGGG + Exonic
1006909399 6:37554492-37554514 AGGTTACAGGAGAGGGAAGAGGG + Intergenic
1006933233 6:37699711-37699733 AGGAGAGAAAAGACGGAAGAGGG - Intergenic
1007249049 6:40483274-40483296 AGGGGAGAGAAGATGGTAGAAGG - Intronic
1007253295 6:40511037-40511059 AGGTGAGACCATGGGGGAGAAGG + Intronic
1007307261 6:40916913-40916935 AGATGAGACCAGAGTCAAGAAGG + Intergenic
1007530199 6:42535352-42535374 AGGTCTGAGAAGAGGAAAGAAGG - Intergenic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007736503 6:43985344-43985366 AGCTGCGAGAGGAGGGAAGAGGG + Intergenic
1007749390 6:44062853-44062875 GGGAGAGGGCAGAGGCAAGATGG - Intergenic
1007767137 6:44167156-44167178 TGTAGAGAGCAGAGGGCAGAGGG - Intronic
1007780620 6:44251997-44252019 AGGTGAGAGCAAAGAGCAGGTGG + Exonic
1007925544 6:45646770-45646792 AGCTGAGGGTAGAGGGCAGAGGG + Intronic
1007926939 6:45657337-45657359 TGGAGAGAGCCAAGGGAAGAAGG - Intronic
1008505564 6:52226433-52226455 AGGTGAGAGCTGAGGAAAGATGG + Intergenic
1008545029 6:52576775-52576797 AGGTGAGAGCCTGGGGAGGAGGG - Exonic
1008614646 6:53214721-53214743 AGGGGAGAACAGTGGGAGGAGGG - Intergenic
1009584874 6:65587467-65587489 AGGAGAGAGCTAAGGGAAGGGGG - Intronic
1010137192 6:72569477-72569499 TGTTGAGAGCAGTGGTAAGAGGG - Intergenic
1010477659 6:76308323-76308345 AGGTGAGAACAGAGGGAAATGGG - Intergenic
1010621516 6:78082472-78082494 AGGAAAGGGTAGAGGGAAGAGGG + Intergenic
1011025690 6:82867005-82867027 AGGGGAGAGCAACGTGAAGATGG - Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011301593 6:85879944-85879966 AGGTTAGAGCAAAGTGAAAAAGG + Intergenic
1011430506 6:87281460-87281482 ATGAGAGAGGAGAGGGAAAAAGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012581751 6:100878757-100878779 GTGTGAGAGCAGAGGAAAAACGG - Intronic
1012687094 6:102265688-102265710 GGCTGAGGACAGAGGGAAGATGG - Intergenic
1012858417 6:104529531-104529553 GGTTGAGAGCAGATGGCAGAGGG - Intergenic
1013080595 6:106808631-106808653 AAGAGAGAGCAGGGGGAAAAGGG - Intergenic
1013633515 6:112007819-112007841 AGGTCAGAGCAGAGGTGGGAGGG - Intergenic
1013792053 6:113848464-113848486 AGATGAGATCAGAGATAAGAAGG - Intergenic
1013815268 6:114090440-114090462 AGGACAGAGAAGAGGGAGGAGGG - Intronic
1014391996 6:120874313-120874335 AGGGAAGAGCGGGGGGAAGAGGG - Intergenic
1014510224 6:122311546-122311568 AGGATAGAGAGGAGGGAAGAAGG - Intergenic
1014634467 6:123828141-123828163 ATGTGAGTGCAGAGGAAGGATGG - Intronic
1014659652 6:124152998-124153020 AGGGAAGAAGAGAGGGAAGATGG + Intronic
1014664379 6:124218993-124219015 AGGAGAGAGAATAGTGAAGAAGG + Intronic
1014718062 6:124888488-124888510 AGGTGACATCAGAGGGTATATGG - Intergenic
1014884637 6:126764791-126764813 AGGGGAGAACAGATGGAAGAGGG + Intergenic
1015129863 6:129796933-129796955 AGGAGAGAGAAGAGCGAAGGAGG + Intergenic
1015211943 6:130708611-130708633 TGGTGAGAGAGGAAGGAAGAAGG + Intergenic
1015414648 6:132934557-132934579 AGGGGAGAAGACAGGGAAGAAGG + Intergenic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1015901361 6:138071367-138071389 AGAGAAGAGGAGAGGGAAGAGGG - Intergenic
1015925643 6:138307986-138308008 GGGCGAGAGCACAGGGAAGCTGG - Intronic
1015966237 6:138697281-138697303 AAGTGACTGCAGATGGAAGAGGG - Intergenic
1016350348 6:143160107-143160129 AGGGAAGGACAGAGGGAAGAGGG - Intronic
1016546417 6:145229247-145229269 AGGGGAGAGGAGAAGGAAAAGGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017256578 6:152340282-152340304 AGGTGTGAGCAGAGGTCGGAGGG + Intronic
1018071363 6:160167238-160167260 AGGTGAGAGGAGATGGGAGGTGG + Intergenic
1018090561 6:160343834-160343856 AGGTGAGGGGAGAGGAAAGGTGG + Intergenic
1018105458 6:160482114-160482136 AGGGAAGAGCAAAGGCAAGAAGG - Intergenic
1018468314 6:164072747-164072769 AGTTAAGAGCTGAGGGAAGAAGG + Intergenic
1019018766 6:168900484-168900506 AGGGGTGAGAAGAGGGAAGCAGG + Intergenic
1019018815 6:168900664-168900686 AGGAGTGAGAAGAGGGAAGCAGG + Intergenic
1019059017 6:169242604-169242626 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059061 6:169242729-169242751 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059098 6:169242836-169242858 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059137 6:169242952-169242974 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059159 6:169243025-169243047 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019059177 6:169243075-169243097 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059193 6:169243125-169243147 AGGTGGGAGCGGTGGGAAGGTGG - Intronic
1019173038 6:170145507-170145529 AGGAGAGAGCAGGGAGAGGAGGG + Intergenic
1019415620 7:925445-925467 AGGGGAGGCCGGAGGGAAGAGGG - Intronic
1019494920 7:1333357-1333379 AGGAGAGAGGAGGGGGAGGAGGG - Intergenic
1019805079 7:3117685-3117707 GGGGGAGAAGAGAGGGAAGAAGG + Intergenic
1019964848 7:4490500-4490522 AGCTGGGAGCAGAGGGAGGCTGG - Intergenic
1020080004 7:5282150-5282172 AGATGGGAGCAGAGGGGAGGAGG + Intronic
1020310437 7:6863496-6863518 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1020985227 7:15125296-15125318 AGGGCACAGAAGAGGGAAGAAGG - Intergenic
1021071196 7:16243195-16243217 AGGTGAGAGAAGAATGAAGGAGG - Intronic
1021269413 7:18566904-18566926 AGGTGAGAGAAGACAGAGGAAGG + Intronic
1021382453 7:19984196-19984218 TGAGGAGAGGAGAGGGAAGAGGG - Intergenic
1021470871 7:21001339-21001361 AGGGGAGAAGAAAGGGAAGAAGG + Intergenic
1021593773 7:22293327-22293349 AGGGGAGAGCTGAGGGCAGGAGG - Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021715523 7:23458584-23458606 AGGTTAGAGCAGAGGGCATGGGG - Intronic
1022013739 7:26330584-26330606 AGGAGAGGGCAGAGGAAGGACGG + Intronic
1022383849 7:29884279-29884301 AGGTGGGAGCAGAGGGAGCGGGG - Exonic
1022547393 7:31201688-31201710 AGGCCAGGGCAGAGGGCAGAGGG + Intergenic
1022569946 7:31442525-31442547 ATGAGAGAGCAGAGAGGAGACGG + Intergenic
1022625269 7:32029571-32029593 GGGTGGGAGGAGAGGAAAGAAGG + Intronic
1022632527 7:32098779-32098801 AGGTGATAGAAGAGAGATGATGG - Intronic
1022761884 7:33364615-33364637 AGGGGAGAGGAGGGGGAAGGGGG - Intronic
1023018195 7:35986388-35986410 AAGTGAGAGGAGGGAGAAGAAGG + Intergenic
1023056008 7:36290639-36290661 TGGTGAGGTCTGAGGGAAGAAGG - Intronic
1023062680 7:36343454-36343476 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1023062686 7:36343466-36343488 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1023088075 7:36592326-36592348 AGGCTGTAGCAGAGGGAAGATGG + Intronic
1023107994 7:36782107-36782129 AGCTGAGAGCAGACAGAAGTTGG + Intergenic
1023134854 7:37041132-37041154 AGTTGAGATCAGAGAAAAGAGGG + Intronic
1023348258 7:39293567-39293589 ACGTGATAGCCGAGGGAAGCAGG + Intronic
1023457144 7:40352457-40352479 ACTTGAGAGTAGAGGGAAGGAGG - Intronic
1023498575 7:40824377-40824399 AGGCAAGAACAGAGGGAGGAGGG + Intronic
1023770001 7:43548526-43548548 AGTGGAGAGCAGAGGGATGCAGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1024064613 7:45722021-45722043 AGGTGAGGGCAGTGGGAAGCTGG + Exonic
1024311613 7:47974671-47974693 AGGAGGGAGCAGGGGGAGGAGGG + Intronic
1024461098 7:49660348-49660370 TGATGAGAGCACAGGGAAGTGGG - Intergenic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024526387 7:50353480-50353502 AGGTGAGGATAGAGGGAGGAGGG - Intronic
1024661738 7:51501863-51501885 AGGAGAGAGGAGAAGGGAGAGGG + Intergenic
1024757451 7:52552291-52552313 GAGTGAGAGCTGAGCGAAGAGGG - Intergenic
1025198910 7:56950066-56950088 AGATGGGAGCAGAGGGGAGGAGG - Intergenic
1025673036 7:63626867-63626889 AGATGGGAGCAGAGGGGAGGAGG + Intergenic
1025796214 7:64739617-64739639 GGGAGAGGGGAGAGGGAAGAGGG + Intergenic
1025796216 7:64739624-64739646 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
1025837139 7:65104774-65104796 AGGTGAGAGATGATGGCAGATGG - Intergenic
1025906919 7:65794284-65794306 AGGTGAGAGATGATGGCAGATGG - Intergenic
1026534932 7:71231693-71231715 AGGAGAGAGAAAAGAGAAGAGGG + Intronic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1026901525 7:74040027-74040049 AGGTGAGTGCAAAGGAAGGAGGG + Intronic
1026984442 7:74546100-74546122 GGGTGAGGGCGGAGGGATGAGGG - Intronic
1027238777 7:76314046-76314068 GGGTGGGAGCTCAGGGAAGACGG - Intergenic
1027721228 7:81744026-81744048 AAGTGAGAGCAGAAGGGATATGG - Intronic
1028120004 7:87046693-87046715 AGGAGAGAGAAGAGTGAAGGAGG - Intronic
1028325017 7:89512866-89512888 ATGAGAGGGCAGAGAGAAGAAGG - Intergenic
1028892881 7:96008307-96008329 GGGAGAGAGCAGAGGGAAGGGGG + Intronic
1029077140 7:97943825-97943847 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1029088297 7:98028565-98028587 AGGTGAGTGCAGAAGGGTGAAGG + Intergenic
1029103337 7:98152804-98152826 AGGTGAAAGCAGGGAGGAGATGG + Intronic
1029248707 7:99220855-99220877 GGGGGAAAGGAGAGGGAAGAAGG + Intergenic
1029569493 7:101360311-101360333 AGGAGAGGGGAGAGGGGAGAGGG + Intergenic
1029584784 7:101463528-101463550 AGGGGAGGGAAGGGGGAAGAGGG - Intronic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1029697156 7:102221053-102221075 AGGTTAGGGGAGAGGGGAGAGGG - Intronic
1029890295 7:103921827-103921849 AGGTAAGAGCAGAGGCCAGGAGG - Intronic
1030367208 7:108658901-108658923 TGGTCAGAGCAGAAGGAAAAGGG - Intergenic
1030422231 7:109321998-109322020 ATGTGAGAGTAGAGTGAAGCAGG + Intergenic
1030463411 7:109869383-109869405 AGGAAAGGGCAGAGAGAAGAAGG - Intergenic
1030875784 7:114811487-114811509 AGGGGAGAGCAGAGAAAAAAGGG + Intergenic
1030891433 7:115003814-115003836 AGGAGAGAACATAGGGTAGAAGG - Intronic
1031017580 7:116592624-116592646 AGCTAAGGGCAGAGTGAAGAGGG + Intergenic
1031198788 7:118650729-118650751 AGGTAAGAGGAGAGTGAAGTCGG + Intergenic
1032055522 7:128681477-128681499 AGAGGAGAGCAGAGGAAAGGAGG - Intronic
1032492066 7:132331223-132331245 AGCTGAGAGCAGGAGGAAGATGG + Intronic
1032530511 7:132615854-132615876 GGGAGAGAGGAGAGGGGAGAGGG - Intronic
1032880438 7:136084374-136084396 GGGTGAGAGCTGTGGGGAGAAGG - Intergenic
1032928414 7:136636803-136636825 GGGTGAGGGGAGAGGGGAGAGGG + Intergenic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1032991951 7:137403525-137403547 AGGGCAGAGCAGAGGGGAGAGGG + Intronic
1033200443 7:139363658-139363680 AGTTGTTAGCAGAGGGGAGAGGG + Intronic
1033247036 7:139726386-139726408 ATGTGAGAGCAAAGGAAAGAGGG + Intronic
1033291693 7:140090371-140090393 TGGGGAGTGCAGAGGGAAGGTGG + Exonic
1033528755 7:142243112-142243134 AGGGAAGTGCAGAAGGAAGAAGG - Intergenic
1033736099 7:144223243-144223265 AGGTGAGAGAAGAGAATAGATGG + Intergenic
1033746954 7:144327709-144327731 AGGTGAGAGAAGAGAATAGATGG - Intergenic
1033828187 7:145218367-145218389 AGGTGAGAGAGGAGAGCAGAGGG - Intergenic
1033846705 7:145442481-145442503 AGTTGATATCAGAAGGAAGATGG + Intergenic
1034422210 7:150995997-150996019 GGATGGGAGCAGAGGGAGGAGGG - Intronic
1034471798 7:151258709-151258731 AGGTGAGAGCAGAGGGGACAGGG - Intronic
1035041209 7:155928873-155928895 AGGCGAGAGCTGGAGGAAGAGGG - Intergenic
1035181565 7:157093113-157093135 CGGTGAGGACAGAGGTAAGATGG - Intergenic
1035349976 7:158238882-158238904 AGGTGAGAGCAGAGGTGTGAAGG + Intronic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1036240645 8:7078121-7078143 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036261410 8:7243457-7243479 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036286995 8:7451632-7451654 AGGAGACAGCAAAGTGAAGAAGG + Intronic
1036305189 8:7596099-7596121 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036313450 8:7702001-7702023 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036334486 8:7859889-7859911 AGGAGACAGCAAAGTGAAGAAGG - Intronic
1036356039 8:8044095-8044117 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036550979 8:9814733-9814755 AGGGGAGAGGAGAGGGGAGAGGG - Intergenic
1036819134 8:11925370-11925392 TGGTGAGACGAGAGGGAAGTAGG - Intergenic
1036832304 8:12030436-12030458 TGGTTAGAACAGAGGGAAGTAGG - Intergenic
1036865108 8:12389604-12389626 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1037194209 8:16167644-16167666 AGGTAAGGACAGAGGGAAGGTGG - Intronic
1037317456 8:17612349-17612371 AGAAGAGAGGAGAAGGAAGAAGG - Intronic
1037448993 8:18997757-18997779 AGGTAAGTGCACCGGGAAGAGGG - Intronic
1037854968 8:22365422-22365444 AGTGGAGAGCAGAGAGAAGTGGG + Intergenic
1037928059 8:22860382-22860404 AGCTGGGGGGAGAGGGAAGAGGG - Intronic
1038228411 8:25678251-25678273 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1038269561 8:26064261-26064283 AGGTGACACCAGATGGATGATGG + Intergenic
1038287108 8:26215191-26215213 GGGTTAGAGAAGAAGGAAGAAGG + Intergenic
1038315166 8:26478194-26478216 AGGAGAGAGAAGAGCGAAGGAGG - Intronic
1038523800 8:28256379-28256401 AGGAGAGGGGAGAGGGGAGAGGG + Intergenic
1038715660 8:29988348-29988370 AGTTCAGAGCAGAGGGAGGTGGG - Intergenic
1038761042 8:30384482-30384504 AGGGGAGAGGGGAGGGAGGAAGG + Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039099373 8:33924487-33924509 AGGGCAAAGGAGAGGGAAGAAGG - Intergenic
1039133076 8:34289945-34289967 GGGTGAGTGCAGAGGGAGGGAGG + Intergenic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039862132 8:41468148-41468170 AGGAGAGAACACAGAGAAGAAGG + Intergenic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1039963803 8:42269659-42269681 AGGAGAGGGAAGAGGGGAGAGGG + Intergenic
1040626605 8:49157155-49157177 AGGAGTGAGCAGGGAGAAGATGG - Intergenic
1040921969 8:52631135-52631157 AGGAGAAGGCAGAGGGGAGAAGG + Intronic
1041180137 8:55238593-55238615 AGATGAGGGCACAGGGAAGTGGG - Intronic
1041324584 8:56651355-56651377 AGGTGAGAGAGGAAGCAAGATGG + Intergenic
1041340815 8:56843808-56843830 AGGAGAGAGCAGAGGAACCAAGG - Intergenic
1041639747 8:60184467-60184489 GGCTGGGAGCTGAGGGAAGAGGG - Intergenic
1041718993 8:60959497-60959519 GGGTGAGAGAAGAAGGAAGGTGG - Intergenic
1041788595 8:61664663-61664685 AGGGGAGATAAGAGGGAAAAGGG + Intronic
1041871605 8:62640614-62640636 GGGTCAGGGCAGAGGAAAGAAGG - Intronic
1042176516 8:66042677-66042699 GGGGGAGAGAGGAGGGAAGAGGG - Intronic
1042242843 8:66681983-66682005 AGAGGAGAGGAGAGGGAGGAAGG - Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043011769 8:74889791-74889813 AGGAAAGAGGACAGGGAAGATGG - Intergenic
1043417318 8:80064312-80064334 AGGGGAGAGGAGATAGAAGAGGG - Intronic
1043601812 8:81948698-81948720 AGGTAAGAGCACAGGGTTGAGGG + Intergenic
1043660961 8:82739932-82739954 ATCAGAGAGCAGAGGGAAGATGG + Intergenic
1044743002 8:95346829-95346851 AGGAGAGAGAAGAGAGGAGAAGG - Intergenic
1044847068 8:96392468-96392490 AGGTGGGAACAGAGGGGTGAAGG - Intergenic
1044966347 8:97577437-97577459 AGGACAGAGCAGAAGGAGGATGG + Intergenic
1045049165 8:98307107-98307129 AGAGGAGAGGAGAGGGGAGAGGG - Intergenic
1045171754 8:99678114-99678136 AGGAGAGAGAAGAGAGAAAATGG - Intronic
1045234058 8:100334424-100334446 AGGTAAGAACAGAGGAAAGGAGG - Intronic
1045299070 8:100895185-100895207 ATGTGAGAACAGTGAGAAGATGG + Intergenic
1045708031 8:104949884-104949906 AGCTGATAGCAGAGGAAAAATGG - Intronic
1046847045 8:118929182-118929204 ATGTGAGAGGAAAGGAAAGAAGG + Intronic
1046863378 8:119119181-119119203 ATGTGAGAGGAGAGGAAACAAGG - Intergenic
1047113611 8:121817520-121817542 AGAGGAGAGGAGAGGGAAAAGGG + Intergenic
1047374874 8:124286440-124286462 AGGAGAGAGGAGAGAGAGGAGGG - Intergenic
1047462894 8:125085733-125085755 AGGGGTGAGCAGATGGTAGAAGG + Intronic
1047682072 8:127264510-127264532 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1047732187 8:127736823-127736845 AGGAGAAGGCAGAGGGAAAACGG + Intronic
1047880849 8:129191233-129191255 AGTTAAGAGCATTGGGAAGAAGG + Intergenic
1047881191 8:129195502-129195524 AGGTGAGGGTATAGGAAAGAGGG + Intergenic
1047994066 8:130316700-130316722 AGGTGAGATCAAAAGGAAGGAGG + Intronic
1048201835 8:132381014-132381036 AGGATAGAGCAAAGGGAAAATGG + Intronic
1048436511 8:134423465-134423487 AGGTTTGAACAGAGGTAAGAGGG - Intergenic
1048508834 8:135044185-135044207 AGGTGATAGCAAAGGGTGGAAGG + Intergenic
1048574453 8:135679907-135679929 AGGGTAGAGCAGAGGGGAGAAGG - Intergenic
1049196084 8:141316392-141316414 AGTTGAGGGCAGAGGGTCGAAGG - Intergenic
1049224530 8:141443515-141443537 AGGTAATGGGAGAGGGAAGAGGG - Intergenic
1049249756 8:141581988-141582010 GGCTGAGATCAGAGGGCAGAGGG + Intergenic
1049311771 8:141937360-141937382 AGGTGGGAGGGAAGGGAAGAGGG - Intergenic
1049350519 8:142162044-142162066 AGGAGAGAGCAGGGGGCATAAGG - Intergenic
1049390676 8:142368709-142368731 AGGTGCCAGCAGACGGCAGACGG + Intronic
1049712411 8:144071256-144071278 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1049737698 8:144218674-144218696 AGGAGAGAGGGGAGGGGAGAGGG - Intronic
1050366619 9:4879106-4879128 AGGTGAGGGAAGAGGAAAGTTGG + Intronic
1050753639 9:8972502-8972524 AGGGAAGAGGAGAGGGAAGGAGG + Intronic
1050985453 9:12076601-12076623 AGGGGAGAGGAGAGTGGAGAGGG - Intergenic
1050996410 9:12224497-12224519 TGGTGAGAGAAGAAGCAAGAAGG + Intergenic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1051102053 9:13532905-13532927 AGATGAGAGCAGAAGAAAGGAGG + Intergenic
1051150285 9:14072330-14072352 AGGGGAGAGGAGAGTGAAGAGGG + Intergenic
1051240451 9:15050082-15050104 AGGGGAGAGGAGAGGGGAGGCGG + Intergenic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1051443709 9:17116830-17116852 ACGTGAGAGCAAGAGGAAGAGGG - Intergenic
1051483651 9:17585621-17585643 AGGTGGGAGCAGAGAGAGCAAGG + Intronic
1051492997 9:17688048-17688070 AGGTGAAAGCAGGGAGCAGAAGG - Intronic
1051681403 9:19611413-19611435 AGGGCAGAGAAGAGGGAAGGAGG + Intronic
1051783868 9:20721251-20721273 TGGTGAGAGGTGAGGGAAGGGGG - Intronic
1052041238 9:23741491-23741513 AGTTGAGAGGGGAGGGAAGAAGG - Intronic
1052050920 9:23849273-23849295 AGGAGAGGGCAGTGGGAAGGAGG + Intergenic
1052574060 9:30268569-30268591 AGGAAAGAGCAGAGGAGAGAAGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052951913 9:34219941-34219963 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1052951973 9:34220060-34220082 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1053273688 9:36767323-36767345 AGGTAAGAGCAGAGGAGAGCAGG + Intergenic
1053329322 9:37188834-37188856 AGGGGAGGGGAGAGGGAAGAGGG - Intronic
1053511588 9:38692592-38692614 AGTTGAGAGTAGAGGAAAAAGGG + Intergenic
1053609252 9:39694586-39694608 AGGTGAGGGCAAAGGGCAAAGGG + Intergenic
1053678160 9:40459824-40459846 AGGTGAGAGGAGAGGAAGTAGGG - Intergenic
1053867091 9:42450858-42450880 AGGTGAGGGCAAAGGGCAAAGGG + Intergenic
1054089064 9:60776902-60776924 AGGTGAGGGCAAAGGGCAAAGGG - Intergenic
1054244273 9:62647811-62647833 AGGTGAGGGCAAAGGGCAAAGGG - Intergenic
1054453920 9:65420099-65420121 AGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1054558399 9:66682359-66682381 AGGTGAGGGCAAAGGGCAAAGGG - Intergenic
1054832404 9:69640900-69640922 AGGAAAGAGGAGAGGGGAGAGGG + Intronic
1054832407 9:69640907-69640929 AGGAGAGGGGAGAGGGGAGAGGG + Intronic
1054918900 9:70522346-70522368 GTGTGAGAGCAGAGGAAAAATGG - Intergenic
1055008747 9:71539282-71539304 AGCTAAGAGCAGATGGAAGAAGG - Intergenic
1055018543 9:71645053-71645075 AGGAAAGAGAGGAGGGAAGAGGG - Intergenic
1055757959 9:79574173-79574195 AGCTGAGAGCCCAGGGAAGTCGG + Intronic
1055786960 9:79881541-79881563 AGGGGAGGGAAGAGGGGAGAAGG - Intergenic
1056137764 9:83646621-83646643 AGGGGAGGGGAGAGGGAAGGGGG + Intergenic
1056409411 9:86311583-86311605 GGGAGAGGGGAGAGGGAAGAGGG - Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057562549 9:96139907-96139929 AAGGGAGAGCAGCTGGAAGAGGG - Intergenic
1057755502 9:97831806-97831828 AGGGGAGATAAGAGGGTAGAGGG + Intergenic
1057929457 9:99180928-99180950 ATGAGAGATCAGAGGGCAGAGGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058553054 9:106136328-106136350 AGATGAGAGCAGAGGGACCACGG + Intergenic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058607962 9:106743725-106743747 AGGGGAGGGAAGATGGAAGAGGG - Intergenic
1058681036 9:107440429-107440451 AGAGGAAAGGAGAGGGAAGAGGG + Intergenic
1059171643 9:112130424-112130446 AGGAGAGAGGAGAGGGGAGAAGG + Intronic
1059215005 9:112553167-112553189 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1059424865 9:114214700-114214722 AGATGGGAGCAGAGAGAAGAGGG - Intronic
1059435912 9:114276123-114276145 AGGTGACAGGGGAGTGAAGAAGG - Intronic
1059459132 9:114418614-114418636 AGGCCAGAGCAGAGGGAGTACGG - Intronic
1059534550 9:115069409-115069431 AGAGGAGAGGAGAGAGAAGAGGG + Intronic
1059713590 9:116892519-116892541 AGGTGAGAGCAAAAGAGAGAAGG + Intronic
1060047749 9:120354021-120354043 AGCTGAGAGCACAGGGCAGAGGG + Intergenic
1060106982 9:120878668-120878690 AGGTGAGAGCAGGGGGATCAAGG - Intronic
1060197207 9:121631478-121631500 GGGAGAGAGCAGAGGGAGGTGGG + Intronic
1060216699 9:121742754-121742776 AGGTGAAAGCAGAGAAAAGCGGG - Intronic
1060273930 9:122167935-122167957 CGATGAAAGCAGAGGGACGAAGG - Intronic
1060348388 9:122836746-122836768 TGGTGAGAGCAGAAGCAAGGTGG + Intergenic
1060471388 9:123951447-123951469 TGGTGGGAGCAGAGGGAATGAGG + Intergenic
1060497565 9:124129642-124129664 AGGTGAGAGATGATGGAGGAAGG + Intergenic
1060701135 9:125748908-125748930 AGGCGAAAGGAGAGGGAAGAGGG - Intronic
1060809049 9:126599264-126599286 AGGAGAGAGAAGAGTGAGGAAGG + Intergenic
1060822025 9:126666770-126666792 AGGAGACAGCAGAGGGGACAAGG + Intronic
1060911662 9:127356016-127356038 AGTCAAGAGCAGAGGGAACAAGG + Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061131866 9:128712994-128713016 TGGTGGTAGCAGTGGGAAGATGG + Intronic
1061149558 9:128821093-128821115 AGGTGACAGCAGGGAGAAGCGGG - Exonic
1061246045 9:129401735-129401757 AGGGGGGAGGAGAAGGAAGAGGG - Intergenic
1061250223 9:129422059-129422081 AGGTGGGGTCAGAGGGCAGATGG - Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061597808 9:131643587-131643609 AGGGTAGAGCTGAAGGAAGAAGG + Intronic
1062184346 9:135209541-135209563 AGCTGCTAGCTGAGGGAAGAGGG + Intergenic
1062275165 9:135727093-135727115 AGGGGAGAGAAGGGGAAAGAGGG - Intronic
1062321123 9:135990923-135990945 AGGGGAGAGGAGAGGAGAGATGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062469769 9:136697144-136697166 AGGAGAAGGGAGAGGGAAGAGGG - Intergenic
1185499350 X:585156-585178 AGGAGGGAGAAAAGGGAAGAGGG + Intergenic
1185545817 X:943356-943378 AGATGAGAGGAGAGAGAGGAGGG + Intergenic
1185623751 X:1468779-1468801 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623784 X:1468851-1468873 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623795 X:1468875-1468897 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623809 X:1468909-1468931 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623833 X:1468968-1468990 AGGAGAGGGGAGAGGGGAGAGGG - Intronic
1185623842 X:1468992-1469014 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185623853 X:1469016-1469038 AGGGGAGGGGAGAGGGGAGAGGG - Intronic
1185647993 X:1628707-1628729 GGGAGAGAGGAGGGGGAAGATGG - Intronic
1185648000 X:1628728-1628750 AGGAGACAAGAGAGGGAAGATGG - Intronic
1185726685 X:2427278-2427300 AGGGAAGAGAGGAGGGAAGAAGG + Intronic
1186159014 X:6757048-6757070 AGAGCAGAGCAGAGAGAAGACGG + Intergenic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186306722 X:8268397-8268419 AGTAGAGAGAAGAGGGAAGCTGG + Intergenic
1186373206 X:8967833-8967855 AGGTGGCAGGAGAGAGAAGAGGG + Intergenic
1186573173 X:10737662-10737684 AGGAAAGAGAAGAGAGAAGAAGG + Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187030532 X:15483500-15483522 AGGTGAGAGGAGAGGAGAAAAGG - Intronic
1187059874 X:15775918-15775940 AGATGAGAGGAGAGGGAAAGAGG - Intronic
1187118294 X:16375987-16376009 AGGTGAGTGCAAAGAGAATAGGG + Intergenic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187323010 X:18257948-18257970 AGGGGAGAGGAAAGGGAAGGGGG + Intronic
1187401051 X:18960502-18960524 TGGTGAGAGCAGAAGCAAGAGGG + Intronic
1187796473 X:23008945-23008967 AGGTGATGGGAGAGGGAAGGTGG - Intergenic
1187936482 X:24341187-24341209 AGGTGAGTGGGCAGGGAAGATGG + Intergenic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1188221882 X:27550673-27550695 AGGGGAGAGGGGAGGGAAGATGG - Intergenic
1189195459 X:39148577-39148599 AGGTGATAGAAGAGGGGTGATGG - Intergenic
1189235099 X:39480871-39480893 AGGGGAGTGGAGAGGGGAGATGG + Intergenic
1190016528 X:46832258-46832280 AGGTGAGTGCAGAGTGAGCAAGG + Intergenic
1190044670 X:47102190-47102212 AGGTGAGGTCAGAGAGAAGTAGG + Intergenic
1190101022 X:47523385-47523407 AGGTGAGGGAAGAGGAAAGGAGG + Intergenic
1190275078 X:48894038-48894060 AGGTGAGAGCAGGCAGAACAGGG + Intronic
1190298021 X:49039956-49039978 AGGGGAGGGGAGGGGGAAGAGGG - Intronic
1190324764 X:49199817-49199839 AGGGGAGAGTGGAAGGAAGATGG - Intronic
1190550025 X:51570417-51570439 CTGTTAGAGCAGAGGAAAGATGG + Intergenic
1191654150 X:63577515-63577537 TGGTGACAGCATAGGGAGGAGGG - Intergenic
1191663838 X:63677660-63677682 GGGTGAGAGGAGAGGGAATCAGG + Intronic
1192333830 X:70201284-70201306 AGGTGAGCGCAGGGCAAAGATGG + Intronic
1192363824 X:70455129-70455151 AGGAGAGAGGAGGGGGAAGGAGG - Intronic
1192496509 X:71619915-71619937 AGGGGAGAGCTGAGGGCAGGTGG - Intergenic
1192580807 X:72279374-72279396 ATCTGAGAGCACTGGGAAGATGG + Intronic
1192806612 X:74515286-74515308 AGATGAGAGAAGACAGAAGAAGG + Intronic
1193889215 X:87022509-87022531 AGGAGAGAGCAGAGGGAAGGAGG + Intergenic
1193972062 X:88067259-88067281 AGGGCAGTGCAGAGGGAAAATGG + Intergenic
1193996209 X:88367929-88367951 AGGAGAGAGAAGAGTGAAGGAGG + Intergenic
1194426691 X:93747686-93747708 AGATCAGAGCAGAGTGGAGAAGG - Intergenic
1195097105 X:101513701-101513723 TGCTGAGAGCAGAGGGAATATGG - Intronic
1195252965 X:103065742-103065764 AGAAGAGAGAAGAAGGAAGAAGG - Intergenic
1195252966 X:103065749-103065771 AGAAGAGAGAAGAGAGAAGAAGG - Intergenic
1195325301 X:103753436-103753458 AGGTGAGGGAAGACAGAAGAAGG - Intergenic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1195750527 X:108159021-108159043 AGGAGACAGCAGAGGCCAGAGGG + Intronic
1195804086 X:108743143-108743165 AGGAAAGGGCAGAAGGAAGAAGG + Intergenic
1196237463 X:113299815-113299837 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1196237469 X:113299827-113299849 AGGGGAGAGAGGAGGGGAGAGGG - Intergenic
1196237522 X:113299933-113299955 AGGGGAGAGGAGAGGGGAGGGGG - Intergenic
1196396969 X:115274838-115274860 TGGTGAGAGCAGGAGCAAGAGGG - Intergenic
1196644460 X:118101813-118101835 AGGAGAGAGAAGAGTGAAGGAGG - Intronic
1196814791 X:119656472-119656494 AGGTTTGAGCAATGGGAAGACGG + Intronic
1196980864 X:121212146-121212168 GGGCAAGAGCAAAGGGAAGAAGG - Intergenic
1197299324 X:124758870-124758892 AGTTGAGAGGAGGGGGAAGAGGG + Intronic
1197640655 X:128964262-128964284 AGGAGTGAGGGGAGGGAAGAGGG + Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1198129352 X:133678308-133678330 TTGAGAGAGCAAAGGGAAGAGGG + Intronic
1198480746 X:137037641-137037663 AAGTGAGATCAGAGAGAGGAAGG - Intergenic
1199482311 X:148311200-148311222 AGGTGAGAACAGAGAGCTGATGG + Intergenic
1199765881 X:150941484-150941506 AGGTGGGAGCAGACAGAGGAGGG + Intergenic
1200775207 Y:7164440-7164462 AGAAGAAAGCAGAGGGAGGAAGG - Intergenic
1201463614 Y:14255757-14255779 AGGAGGGAGAAGAGAGAAGAAGG - Intergenic
1202163646 Y:21963253-21963275 AGATGAGGGGAGAGGGAAGGAGG - Intergenic
1202227710 Y:22623112-22623134 AGATGAGGGGAGAGGGAAGGAGG + Intergenic
1202315447 Y:23573066-23573088 AGATGAGGGGAGAGGGAAGGAGG - Intergenic
1202379265 Y:24261512-24261534 AGAGGAGAGGAGAGGGGAGAGGG - Intergenic
1202491517 Y:25408609-25408631 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1202555354 Y:26097531-26097553 AGATGAGGGGAGAGGGAAGGAGG + Intergenic