ID: 1076121554

View in Genome Browser
Species Human (GRCh38)
Location 10:127940568-127940590
Sequence TGTTGCTGCACCTCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076121547_1076121554 10 Left 1076121547 10:127940535-127940557 CCCTGCACCCAGCACATTCCTTC 0: 1
1: 0
2: 0
3: 34
4: 373
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121549_1076121554 3 Left 1076121549 10:127940542-127940564 CCCAGCACATTCCTTCCTTCATC 0: 1
1: 0
2: 5
3: 45
4: 428
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121552_1076121554 -8 Left 1076121552 10:127940553-127940575 CCTTCCTTCATCAGGTGTTGCTG 0: 1
1: 0
2: 2
3: 30
4: 181
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121542_1076121554 21 Left 1076121542 10:127940524-127940546 CCCCCTGCTTCCCCTGCACCCAG 0: 1
1: 0
2: 11
3: 113
4: 848
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121548_1076121554 9 Left 1076121548 10:127940536-127940558 CCTGCACCCAGCACATTCCTTCC 0: 1
1: 0
2: 2
3: 35
4: 520
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121545_1076121554 18 Left 1076121545 10:127940527-127940549 CCTGCTTCCCCTGCACCCAGCAC 0: 1
1: 2
2: 7
3: 94
4: 929
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121550_1076121554 2 Left 1076121550 10:127940543-127940565 CCAGCACATTCCTTCCTTCATCA 0: 1
1: 0
2: 0
3: 38
4: 333
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121544_1076121554 19 Left 1076121544 10:127940526-127940548 CCCTGCTTCCCCTGCACCCAGCA 0: 1
1: 1
2: 4
3: 92
4: 1038
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121543_1076121554 20 Left 1076121543 10:127940525-127940547 CCCCTGCTTCCCCTGCACCCAGC 0: 1
1: 1
2: 11
3: 89
4: 896
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data
1076121546_1076121554 11 Left 1076121546 10:127940534-127940556 CCCCTGCACCCAGCACATTCCTT 0: 1
1: 1
2: 44
3: 354
4: 2649
Right 1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076121554 Original CRISPR TGTTGCTGCACCTCTGCTGC TGG Intronic
No off target data available for this crispr