ID: 1076121996

View in Genome Browser
Species Human (GRCh38)
Location 10:127943872-127943894
Sequence TGGGGTGGCAGTATTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076121991_1076121996 -10 Left 1076121991 10:127943859-127943881 CCGTGCCCACTGCTGGGGTGGCA No data
Right 1076121996 10:127943872-127943894 TGGGGTGGCAGTATTGGGCATGG No data
1076121985_1076121996 21 Left 1076121985 10:127943828-127943850 CCTCACGAGCTGGACAGGCAGAC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1076121996 10:127943872-127943894 TGGGGTGGCAGTATTGGGCATGG No data
1076121983_1076121996 27 Left 1076121983 10:127943822-127943844 CCTGTTCCTCACGAGCTGGACAG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1076121996 10:127943872-127943894 TGGGGTGGCAGTATTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076121996 Original CRISPR TGGGGTGGCAGTATTGGGCA TGG Intronic
No off target data available for this crispr