ID: 1076122031

View in Genome Browser
Species Human (GRCh38)
Location 10:127944087-127944109
Sequence CCTGGCCGAAAGTCAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076122031_1076122040 30 Left 1076122031 10:127944087-127944109 CCAAGCTTTGACTTTCGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1076122040 10:127944140-127944162 TGCTGGAAGGACTGAAGTCCAGG No data
1076122031_1076122039 17 Left 1076122031 10:127944087-127944109 CCAAGCTTTGACTTTCGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1076122039 10:127944127-127944149 ATCATGGTTCTGCTGCTGGAAGG No data
1076122031_1076122038 13 Left 1076122031 10:127944087-127944109 CCAAGCTTTGACTTTCGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1076122038 10:127944123-127944145 GCAAATCATGGTTCTGCTGCTGG No data
1076122031_1076122037 1 Left 1076122031 10:127944087-127944109 CCAAGCTTTGACTTTCGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1076122037 10:127944111-127944133 TGGAGAGTGGCAGCAAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076122031 Original CRISPR CCTGGCCGAAAGTCAAAGCT TGG (reversed) Intronic
904489387 1:30848990-30849012 CCAGGCAGACAGTCAAAGCTGGG - Intergenic
908421475 1:63962707-63962729 CCTGTGGGAAAGTCAAAGGTGGG + Intronic
910651592 1:89574101-89574123 CCTGGTCGACAGCCGAAGCTGGG + Intronic
910846495 1:91609639-91609661 CCAGGATGAAAGTGAAAGCTGGG + Intergenic
912852875 1:113142164-113142186 CCTGGCAATAAGTCAGAGCTAGG + Intergenic
913052164 1:115126965-115126987 CCTGGCCTAAAGAGAAAGCTGGG + Intergenic
921690174 1:218139673-218139695 CCTGGCAGAAAGTTACGGCTGGG - Intergenic
1064806779 10:19143880-19143902 CCAGGGAGAAAGTCACAGCTAGG + Intronic
1064904046 10:20325941-20325963 AATGGCCAAAAGGCAAAGCTGGG + Intergenic
1066203643 10:33165757-33165779 CCTGGCCGAAAGTAGAGGCTGGG - Intergenic
1071447566 10:85762916-85762938 CCTAGTCCAAAGTCACAGCTAGG + Intronic
1076122031 10:127944087-127944109 CCTGGCCGAAAGTCAAAGCTTGG - Intronic
1079490662 11:20985726-20985748 ACTGGCCAAAAGTCAAAGCAGGG + Intronic
1081214316 11:40375855-40375877 CATGGCTGGAAGTGAAAGCTGGG - Intronic
1081229070 11:40562816-40562838 CGTTGCAGAAAGTGAAAGCTAGG - Intronic
1085267314 11:75244583-75244605 CCTGGCCCCATGGCAAAGCTGGG - Intergenic
1092024268 12:5227825-5227847 GCTGGGCGAGTGTCAAAGCTGGG + Intergenic
1103263286 12:119608062-119608084 CCTGCCCCAAAGTTAATGCTTGG + Intronic
1103944832 12:124520179-124520201 CCTGCCCCAAAGCCAAAGGTGGG + Intronic
1104482209 12:129117581-129117603 AATGGCCCAAGGTCAAAGCTGGG + Intronic
1106859520 13:33890175-33890197 GCAGGCCTCAAGTCAAAGCTGGG - Intronic
1107707053 13:43118589-43118611 CCTGGCTTAAAGTGAATGCTGGG + Intergenic
1109856919 13:68142416-68142438 CCTTGCAGAAAATAAAAGCTGGG + Intergenic
1111051823 13:82892671-82892693 CCTGGGCGAAAGAGAAAGCTCGG + Intergenic
1116430032 14:44835928-44835950 CCTGGTAGAAAGTTAAAGCGGGG - Intergenic
1116979050 14:51148594-51148616 CCTGGACAAAAGTCAAACTTAGG + Intergenic
1126939998 15:53756800-53756822 ACTTGCCGAAGGTCAGAGCTAGG + Intronic
1128525842 15:68411753-68411775 CCTAGCCCAAAGTCAAGGTTGGG - Intronic
1128976168 15:72155377-72155399 CCTGGCCCAAAGCCAAACCTGGG - Intergenic
1130111408 15:80968418-80968440 CCTTGCTGAGAGTCACAGCTAGG - Intronic
1132400140 15:101500072-101500094 CCAGGCCGTAATTCAAGGCTAGG + Intronic
1134229950 16:12421103-12421125 CCTTGCCTAAGGTCATAGCTGGG + Intronic
1143045026 17:4071338-4071360 CCTGGCCTGAAGTCTCAGCTGGG + Intronic
1147187349 17:38720001-38720023 GGTGGCCGAGAGTCAAGGCTGGG - Intronic
1149053658 17:52336680-52336702 CTTAGCCAAAAGTCCAAGCTTGG + Intergenic
1151418310 17:73981198-73981220 CCTGTCCCCAAGTCAAATCTGGG - Intergenic
1151556098 17:74847505-74847527 ACTTGCCGATAGTGAAAGCTGGG + Exonic
1153818635 18:8813074-8813096 CCTGGCAGACAGTCACAGCCTGG + Exonic
1166831276 19:45641212-45641234 CCTGGGCGAAATTAAAATCTGGG - Intronic
925951905 2:8922709-8922731 CCTGGGGGAAAGTAAGAGCTGGG - Intronic
930110805 2:47676946-47676968 CCTGGCCTAAAGTCATTTCTTGG - Intergenic
935124624 2:100212709-100212731 CCTGGCTGCAAGTCATCGCTGGG - Intergenic
939579802 2:143934754-143934776 CCTGGCAGAAAGACACAGCTAGG + Intergenic
943349585 2:186781483-186781505 CCTGGTCAAAAGTCAAAGATAGG + Intergenic
944140234 2:196448340-196448362 CCTGTCTGGAAGTCAAATCTAGG - Intronic
1169656878 20:7934077-7934099 ACTTGCCCAAAGTCACAGCTAGG - Intronic
1173856326 20:46252687-46252709 CCTGGCACAAAGTTGAAGCTTGG - Intronic
1174538780 20:51273412-51273434 CCTGGGCGAGATTCAGAGCTGGG + Intergenic
1175179043 20:57132053-57132075 CCAGGCTGAAAGTCCTAGCTTGG + Intergenic
1175442871 20:59003236-59003258 CCTGGCCCAGAGGCAGAGCTCGG + Intronic
1175443514 20:59006291-59006313 CCTGGCCCACAGTCAAAGGGCGG + Intronic
1175577396 20:60070998-60071020 CCTGGCCCAAAGTCCCTGCTTGG - Exonic
1183425941 22:37739452-37739474 CCCTGCCGTGAGTCAAAGCTGGG + Intronic
955441670 3:58962713-58962735 CCTAGCAGAGAGTAAAAGCTGGG - Intronic
956037686 3:65112980-65113002 ACTGGCTGAAAGTCAAGGCCAGG + Intergenic
958468998 3:94494865-94494887 TCTTGCAGAAAGTCTAAGCTTGG - Intergenic
967811474 3:193764882-193764904 CCAGCCCAAAAGCCAAAGCTTGG + Intergenic
978002601 4:103574461-103574483 CTTGGGCTAAAGTCAAACCTTGG + Intergenic
985708670 5:1415839-1415861 TCTGGCCGCAGGTCAAACCTAGG + Intronic
998108301 5:139482171-139482193 CCTGGCAGAACGCCAAACCTAGG - Intronic
1001896897 5:175390125-175390147 CCTGGCACAGAGTCAGAGCTGGG + Intergenic
1007472462 6:42099687-42099709 CCTGGCCGAAAGCAACAGCTAGG - Intergenic
1008901249 6:56619056-56619078 CCTGGCGAAAAGTCAAAATTTGG - Intronic
1011495513 6:87933500-87933522 CCTGGAAGAAAACCAAAGCTGGG + Intergenic
1018080929 6:160258840-160258862 CCTGGCCAGAAGTCAAAGAGGGG + Exonic
1023247922 7:38226561-38226583 CTTAGCAGAAAGTAAAAGCTGGG - Intronic
1033833830 7:145284659-145284681 CATGGCAGAAAGTGAAAGGTAGG + Intergenic
1034056836 7:148044345-148044367 CCTGGCCACAAGTCACACCTGGG - Intronic
1042049754 8:64690823-64690845 CCTGGCAGAAAGTGAATGCCTGG - Intronic
1042882851 8:73513475-73513497 CCTGGCAGAAAGTAAATGCCAGG - Intronic
1044959015 8:97511611-97511633 TCAGGCCAAAAGTCAAATCTAGG + Intergenic
1050110674 9:2212139-2212161 CCTAGGAGAAAGTCAAAGGTTGG - Intergenic
1054905608 9:70412104-70412126 CCTTGCCGGAGGTCAAGGCTTGG - Intronic
1061895878 9:133647292-133647314 CCTGGCCCTGCGTCAAAGCTGGG - Intronic
1061951654 9:133939634-133939656 CGAGGCCGACAGTCACAGCTGGG + Intronic
1062303334 9:135888106-135888128 CCTGGCCCAGAGTCCCAGCTTGG + Intronic
1189299645 X:39943250-39943272 CCTGGCCGACTTTCAAAGCTAGG + Intergenic
1190099316 X:47508985-47509007 CCTGTCAGAAAGTAAAAGCCAGG - Intergenic
1190218090 X:48493392-48493414 CCTGCCCCAGAGGCAAAGCTTGG + Intergenic
1192585773 X:72317124-72317146 ACTTGCCCAAAGACAAAGCTAGG - Intergenic
1193789661 X:85802202-85802224 CCTGGCGGACATTAAAAGCTGGG - Intergenic
1199690888 X:150308378-150308400 TCTGGAAGAAAGTCAACGCTTGG - Intergenic
1200776770 Y:7176475-7176497 CCTGGGGCAAAGTCAATGCTGGG - Intergenic
1201339538 Y:12918523-12918545 CTTGGCCTAAAATCAAACCTTGG + Exonic