ID: 1076122036

View in Genome Browser
Species Human (GRCh38)
Location 10:127944105-127944127
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076122036_1076122040 12 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA No data
Right 1076122040 10:127944140-127944162 TGCTGGAAGGACTGAAGTCCAGG No data
1076122036_1076122039 -1 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA No data
Right 1076122039 10:127944127-127944149 ATCATGGTTCTGCTGCTGGAAGG No data
1076122036_1076122038 -5 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA No data
Right 1076122038 10:127944123-127944145 GCAAATCATGGTTCTGCTGCTGG No data
1076122036_1076122041 13 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA No data
Right 1076122041 10:127944141-127944163 GCTGGAAGGACTGAAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076122036 Original CRISPR TTTGCTGCCACTCTCCACCC TGG (reversed) Intronic