ID: 1076122036

View in Genome Browser
Species Human (GRCh38)
Location 10:127944105-127944127
Sequence TTTGCTGCCACTCTCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076122036_1076122041 13 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA 0: 1
1: 0
2: 2
3: 23
4: 311
Right 1076122041 10:127944141-127944163 GCTGGAAGGACTGAAGTCCAGGG No data
1076122036_1076122038 -5 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA 0: 1
1: 0
2: 2
3: 23
4: 311
Right 1076122038 10:127944123-127944145 GCAAATCATGGTTCTGCTGCTGG No data
1076122036_1076122039 -1 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA 0: 1
1: 0
2: 2
3: 23
4: 311
Right 1076122039 10:127944127-127944149 ATCATGGTTCTGCTGCTGGAAGG No data
1076122036_1076122040 12 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA 0: 1
1: 0
2: 2
3: 23
4: 311
Right 1076122040 10:127944140-127944162 TGCTGGAAGGACTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076122036 Original CRISPR TTTGCTGCCACTCTCCACCC TGG (reversed) Intronic
900183176 1:1321289-1321311 TGGGCTGCCAGCCTCCACCCTGG - Intronic
900562012 1:3311866-3311888 TTTGCAGCCCCTCTGGACCCAGG - Intronic
901186333 1:7375687-7375709 TTTACTGCCATCCTCCAGCCTGG - Intronic
901196734 1:7444486-7444508 TTTGCTGCTTCCCTCCTCCCTGG + Intronic
901436970 1:9252894-9252916 TTTCCTCCCAGTGTCCACCCTGG + Intronic
902007621 1:13244926-13244948 TTTGCCACCACACTCCAGCCTGG - Intergenic
902026595 1:13388725-13388747 TTTGCCACCACACTCCAGCCTGG - Intergenic
902076802 1:13793422-13793444 CATGCTGCCCCTTTCCACCCGGG - Intronic
902310733 1:15579573-15579595 GGAGCTGCCACCCTCCACCCGGG + Intronic
902705129 1:18199241-18199263 GTCCCTGCCACTCACCACCCAGG + Intronic
902936812 1:19770262-19770284 GTTCCTTCCCCTCTCCACCCAGG - Intronic
904538528 1:31217206-31217228 TGTGCTGCCACACTCCAACCTGG - Intronic
906536056 1:46551568-46551590 TTCCCTGCCAGCCTCCACCCAGG + Intergenic
906962555 1:50427182-50427204 TTGGCTGATACTCTCCGCCCGGG + Intergenic
907613655 1:55900869-55900891 TGTGCCGCCACACTCCAGCCTGG - Intergenic
908414288 1:63897949-63897971 CTTACTGCCAATCTCCAGCCAGG + Intronic
909658180 1:78053882-78053904 TGTGCTGCTACACTCCAGCCTGG + Intronic
909696525 1:78473870-78473892 ATTGCTGCCACCCTTCACCAGGG - Intronic
910212659 1:84809517-84809539 TGTGCTGCCACACTCCAGCCTGG - Intergenic
910775789 1:90873227-90873249 TCTGCCTCCACCCTCCACCCTGG - Intergenic
911456347 1:98129049-98129071 TTTTCTGCCCCTCTGGACCCAGG + Intergenic
912370715 1:109172026-109172048 TTAGCTCCCACCCTCCACCTTGG - Intronic
912790210 1:112641843-112641865 TGTGCTGCCGCACTCCAGCCTGG + Intronic
913236260 1:116785744-116785766 TTTGCAGACACTCCCCAGCCTGG + Intergenic
913297072 1:117332445-117332467 TGTGCTGCTACACTCCAGCCTGG + Intergenic
916715111 1:167441402-167441424 TTTGGTGCCCCTCCCCACCTAGG + Intronic
917346223 1:174030689-174030711 TGTGCTGCCATACTCCAGCCTGG + Intergenic
917712840 1:177704665-177704687 TCTGCTGCCACTTTGCATCCTGG - Intergenic
918449067 1:184641644-184641666 TTGGCTGCGTCTCTGCACCCAGG + Intergenic
919360442 1:196586218-196586240 TCTGCTGCTACACTCCAACCTGG + Intronic
919711922 1:200737671-200737693 CTTGCCACCACTCTCCAGCCTGG + Intergenic
920861778 1:209714765-209714787 TGTGCTGCCACCTTCCTCCCCGG - Intronic
921241924 1:213193677-213193699 CTTGCCGCCACACTCCAGCCTGG - Intronic
922090091 1:222387541-222387563 TATGTAGCCAGTCTCCACCCAGG - Intergenic
922133085 1:222798250-222798272 TTTGCTGTCACCCTCCAGCCTGG + Intergenic
922878824 1:228963620-228963642 TTTGCTACCACACTCCAGCCTGG - Intergenic
922949993 1:229550818-229550840 TGTGCTGCTACACTCCAGCCTGG + Intronic
923419391 1:233797668-233797690 TTTGCTGCACCTATCAACCCAGG + Intergenic
923459722 1:234197652-234197674 TGAGCTGCCACCCTCTACCCTGG - Intronic
1064249261 10:13694373-13694395 GTAGATGCCACTCACCACCCAGG + Intronic
1064475820 10:15688425-15688447 TGTGCTGCTACACTCCAGCCTGG + Intronic
1064620280 10:17208623-17208645 CCTGCTGCCCCTCTACACCCAGG + Intergenic
1064801182 10:19074216-19074238 ATTTCTGCCACTGTCCAACCAGG + Intronic
1065158339 10:22893845-22893867 GGGGCTGCCACTCTCCACACTGG + Intergenic
1065490379 10:26276423-26276445 TGCGCTGCCACACTCCAGCCTGG - Intronic
1069231617 10:66016289-66016311 TTTGCTCCCAGTCTGCAGCCTGG - Intronic
1069947972 10:72000571-72000593 CTTCCTGCCACTCCCCACCTGGG - Intronic
1071499854 10:86195611-86195633 TTTGCTGCCAACCCCCAGCCAGG - Intronic
1073223078 10:101892413-101892435 TGTGCTACCACGCTCCAGCCTGG + Intronic
1073291932 10:102417363-102417385 GTTGCTTCCTCTCTCCTCCCAGG - Intronic
1076122036 10:127944105-127944127 TTTGCTGCCACTCTCCACCCTGG - Intronic
1076355197 10:129847295-129847317 TTTGCTGCCAGCCTCCATCTAGG - Intronic
1079256483 11:18835437-18835459 TTGGCTGGCACTCTCCTCCCTGG + Intergenic
1080662093 11:34304864-34304886 TTGGCTGCCACTCTCTTCCAAGG + Intronic
1081324739 11:41730180-41730202 TTTGCCACCACACTCCAGCCTGG + Intergenic
1081558321 11:44188191-44188213 TTGGCTCCCACTCACCTCCCAGG - Intronic
1081819855 11:45981998-45982020 TGTGCTGCCGCACTCCAGCCTGG - Intronic
1083322648 11:61856871-61856893 TTTCCTGTCAATCTGCACCCTGG - Intronic
1084108147 11:66994432-66994454 TTTGCTGCTGCACTCCAACCTGG - Intergenic
1084640034 11:70420219-70420241 TTTCCTGCCACTCTCCAAGGAGG + Intronic
1084930130 11:72548686-72548708 TTTGATGCCACTGTCTCCCCAGG + Intergenic
1085151429 11:74255382-74255404 TTTGCTGCCCTCCTCCCCCCTGG + Intronic
1085500388 11:77016653-77016675 TTTTCTCCCTCTCTCCACACAGG + Exonic
1086493894 11:87383281-87383303 TTTGCTGGCATTCTCCTCCCTGG - Intergenic
1089492269 11:118891381-118891403 TATGCTGCTACGCTCCAGCCTGG - Intronic
1089568758 11:119388213-119388235 TTTGCTGTCTCTCTGCACTCAGG + Intergenic
1090481448 11:127072171-127072193 TTTGTTGCTGCTCTCCACCAAGG - Intergenic
1091198348 11:133750836-133750858 CTTCCTGCCACTCTCCTCCCTGG - Intergenic
1094126137 12:27023706-27023728 TTTGCTTCTACTTTCCACTCAGG - Intronic
1094669146 12:32552170-32552192 TTTACTCCCACTTTCCACTCTGG + Intronic
1096168744 12:49448669-49448691 TGTGCTGCCGCACTCCACCCTGG + Intronic
1097079033 12:56416026-56416048 CATGCTGCCACACTCCAGCCTGG + Intergenic
1097233692 12:57526419-57526441 TTGGCTGCCTCTTTCCAGCCAGG - Intronic
1097521493 12:60676253-60676275 TGTGCTGACATTCTCCTCCCTGG + Intergenic
1100188257 12:92161086-92161108 TATTCTGCCACCCTCCATCCAGG - Intergenic
1103294160 12:119871811-119871833 TGTGCTGCCACACTCCAGCCTGG + Intronic
1103368324 12:120399231-120399253 TGTGCTGCCACACTCCAACCTGG + Intergenic
1103979698 12:124728431-124728453 CATGCTGCCACCCTCCAGCCTGG + Intergenic
1104162263 12:126191768-126191790 TTTGCCCCCACTCTCCTACCTGG - Intergenic
1105015648 12:132785347-132785369 TTTGCTGCTGCACTCCAGCCCGG - Intronic
1106263537 13:28090082-28090104 TGTGCCGCCACACTTCACCCTGG - Intronic
1107158660 13:37198899-37198921 TTTGCTTGCATTCTCCTCCCTGG + Intergenic
1107580185 13:41775383-41775405 TATCCTGCCACTCTCCACTTTGG - Intronic
1108606848 13:52047797-52047819 CATGCTGCCACACTCCAGCCTGG + Intronic
1113119135 13:106907628-106907650 TTGGCTTCCACTCTCTACCAGGG - Intergenic
1113227328 13:108173509-108173531 TTTGCTGCTGCACTCCAGCCTGG + Intergenic
1113349219 13:109512172-109512194 TTTCCTGCCCCACTCCAACCTGG + Intergenic
1116072272 14:40063269-40063291 TGTGCCACCACTCTCCAGCCTGG - Intergenic
1117270911 14:54142474-54142496 CTTGCTGCCATTCTCTACCTTGG - Intergenic
1117501757 14:56359392-56359414 GTTGCTGACAATCTCCACCTGGG - Intergenic
1118161069 14:63291053-63291075 TTGGCTGCCATTCTCATCCCTGG - Exonic
1118812434 14:69285082-69285104 CTTGCTGCCCCACTCCAGCCTGG - Intronic
1119368064 14:74112349-74112371 TGTGCTGCTACACTCCAGCCTGG - Intronic
1119413498 14:74453920-74453942 TGTGCTACCACACTCCAGCCTGG + Intergenic
1121031755 14:90664311-90664333 TATGCTACCACACTCCAGCCTGG - Intronic
1121613003 14:95293997-95294019 TTTGGTGTCACCCTCCAGCCAGG - Intronic
1122368269 14:101211647-101211669 TGTGCTACCACACTCCAGCCTGG - Intergenic
1124306886 15:28586465-28586487 TGTGCTGCCACACTGCAGCCAGG - Intergenic
1124795439 15:32773670-32773692 TTGTCTCCCTCTCTCCACCCAGG + Exonic
1126012545 15:44316940-44316962 TGTGCTACTACACTCCACCCTGG + Intronic
1126812605 15:52422926-52422948 TGTGCTACCACACTCCAGCCTGG - Intronic
1127553023 15:60059853-60059875 TTTCCTGCCTCTCTCAGCCCAGG - Intronic
1127862805 15:63008574-63008596 ATGGCTGGCACTATCCACCCTGG - Intergenic
1128215243 15:65930166-65930188 TAAGCTGCCAGACTCCACCCTGG - Intronic
1128219986 15:65962327-65962349 TTTCCTGCCCCACCCCACCCTGG + Intronic
1128405635 15:67334731-67334753 TTTGCAGCGACTCTCAGCCCTGG - Intronic
1128697748 15:69781183-69781205 CCTGCTGCCACTCCCCACCTCGG - Intergenic
1128838355 15:70829484-70829506 TTTGCTGCAATTCTTAACCCTGG - Exonic
1129200904 15:73998642-73998664 TATGCTGCCAGTCCCCACGCAGG + Intronic
1129438809 15:75564120-75564142 TTTGCTGCTGCACTCCAGCCTGG - Intronic
1129886327 15:79040357-79040379 TTTGCTTCCACTCTTGCCCCTGG + Intronic
1130255609 15:82324742-82324764 TTCTCTGCCACTGTCCAACCTGG - Intergenic
1131867931 15:96731625-96731647 TTTACTGCCTATCTCCCCCCCGG + Intergenic
1132163122 15:99561932-99561954 AATGCTGCTACTGTCCACCCAGG + Intergenic
1133314720 16:4875506-4875528 TTAGATCTCACTCTCCACCCGGG - Intronic
1133684868 16:8156730-8156752 TGTGCTACTACTCTCCAACCTGG + Intergenic
1134170113 16:11961734-11961756 TTTGCCACCACACTCCAGCCTGG + Intronic
1136000069 16:27285770-27285792 TTTGCCACCACACTCCAGCCTGG + Intronic
1136088776 16:27903651-27903673 TTTGAGGCCACTCTCCCTCCAGG - Intronic
1136149272 16:28336155-28336177 TCTGCTGGAACTCGCCACCCTGG - Intergenic
1136231531 16:28888450-28888472 TGTGCTACCACACTCCAGCCTGG - Intronic
1136306440 16:29374966-29374988 TCTGCTGGAACTCCCCACCCTGG - Intergenic
1136578030 16:31135610-31135632 CTTGCTGCCCCTTTCCAGCCCGG - Exonic
1136732177 16:32425204-32425226 TTTGCCACCACACTCCAGCCTGG - Intergenic
1137590563 16:49690852-49690874 CTACCTGCCACACTCCACCCGGG - Intronic
1138026114 16:53523670-53523692 TCTCCTGCCACTCTCCTCCCGGG + Intergenic
1139399069 16:66665730-66665752 TATGCTACCACGCTCCAGCCTGG + Intronic
1141646248 16:85369585-85369607 TTAGATGCCCCTCGCCACCCTGG + Intergenic
1141846036 16:86609815-86609837 ATTCCTCCCACTCTCTACCCGGG - Intergenic
1142009917 16:87708720-87708742 CCTCCTGCCACCCTCCACCCCGG + Intronic
1146127347 17:30239516-30239538 CTTGCTGCCACTGTGAACCCTGG + Intergenic
1146287217 17:31582066-31582088 TTTCCTGACAGTCTCCTCCCTGG + Intergenic
1146408231 17:32558271-32558293 TCTGCTGCCCATCTCCAGCCTGG - Intronic
1147012134 17:37458718-37458740 TGTGCTGCTGCTCTCCAGCCTGG - Intronic
1148432854 17:47656494-47656516 TTTGCTACTACACTCCACCCTGG + Intronic
1148750025 17:49940337-49940359 CTGGCTGCCACTCACCACCTTGG - Intergenic
1149097929 17:52866921-52866943 TGTGCTGCTACACTCCAGCCTGG + Intronic
1150561318 17:66297460-66297482 TGTGCCACCACACTCCACCCTGG - Intergenic
1151593242 17:75060700-75060722 GTCGCCGCCACTCGCCACCCTGG + Intronic
1151656054 17:75496519-75496541 TTTGCTGCTACTCCCACCCCAGG - Intronic
1153758795 18:8310415-8310437 TTTCCCACCACTCTCCTCCCTGG + Intronic
1153907146 18:9671993-9672015 TGTGCTACCACACTCCAACCTGG - Intergenic
1153962427 18:10151063-10151085 TTTTCAGCCACTCTCCTTCCTGG + Intergenic
1156218833 18:35030349-35030371 ATCCCTGCCACTCCCCACCCTGG + Intronic
1156628170 18:38934735-38934757 TGTGCTGCCACACTCCAGTCTGG - Intergenic
1157641951 18:49224620-49224642 CTTGCTTCCACTCTCCACCATGG + Intronic
1158592849 18:58792045-58792067 TGTGCTGCCACTCTCCAGCCTGG + Intergenic
1159147170 18:64469129-64469151 CTTGCTGCCCATCTCCACCTGGG - Intergenic
1159921310 18:74229672-74229694 TGTGCTGTCACACTCCAGCCTGG + Intergenic
1160440139 18:78883502-78883524 TTTGCAGGCATTCTCCTCCCTGG - Intergenic
1160894448 19:1396067-1396089 TTTGGGGACCCTCTCCACCCAGG + Intergenic
1161195295 19:2983136-2983158 TTCGCTGCCCCCCTCCTCCCAGG - Intronic
1161330483 19:3684508-3684530 ATTGCTGCCACCCTCCAGCCTGG - Intronic
1161565180 19:4997888-4997910 ACTGCTGTCCCTCTCCACCCAGG + Intronic
1162317123 19:9946297-9946319 TGTGCTACCACACTCCAGCCTGG - Intergenic
1162740494 19:12771054-12771076 CTCCCTGCCACTCTCCAGCCTGG + Exonic
1162798986 19:13100892-13100914 GCTGCTGCAACTCTCCACCCTGG - Exonic
1162984363 19:14259976-14259998 TTTGCTGCTGCACTCCAGCCTGG - Intergenic
1163431755 19:17272359-17272381 TTTGCCACCACACTCCAGCCTGG + Intronic
1164304728 19:23995781-23995803 TTTTTTGTCACTCTCCAGCCTGG - Intergenic
1164670402 19:30069120-30069142 TTTGTTACCACCCTCCAGCCAGG + Intergenic
1164703651 19:30303838-30303860 TTGGCAGCCACTCACCACTCAGG + Intronic
1164783555 19:30912293-30912315 ATTGATGCCACTGTCCAACCTGG + Intergenic
1164887102 19:31788550-31788572 TTTGCTTCCCCTCTCCCCACAGG + Intergenic
1165012385 19:32858394-32858416 TTCGCCGCCCCTGTCCACCCTGG + Intronic
1165452466 19:35892092-35892114 TTTGCCACCACACTCCAGCCTGG - Intronic
1165877686 19:39020896-39020918 TTTGCTACCGCACTCCAGCCTGG - Intronic
1166352205 19:42204708-42204730 TTGGCTGCCTCTCTCCAGCAAGG - Intronic
1167608302 19:50493385-50493407 TCTGCTGCCAGTCACCACACTGG - Intergenic
1167890077 19:52532987-52533009 TTTGCCACCACACTCCAGCCTGG + Exonic
925193147 2:1901758-1901780 TGTGCTGCTGCTCTCCAGCCTGG - Intronic
926344275 2:11931020-11931042 CATGCTGCCAGTGTCCACCCAGG - Intergenic
927596729 2:24403381-24403403 TTTGGTGCCATCCACCACCCAGG + Intergenic
928205254 2:29279317-29279339 AGTGCTGCCTCTGTCCACCCGGG + Intronic
928252975 2:29697923-29697945 TTTGCTCCCACTCTGCAGCAGGG - Intronic
929185283 2:39087752-39087774 TTTGCCTCCCCTCTCCTCCCAGG + Intronic
929786884 2:44999824-44999846 TTTGCAGCCACTTTCTTCCCAGG - Intergenic
929882380 2:45848352-45848374 CCTGCTGCCACACTCCAGCCTGG - Intronic
930048545 2:47194984-47195006 ATTGCTGTCACTGTCCACCTGGG - Intergenic
931052198 2:58428003-58428025 TTTTCTGGCACTTTCCACCGAGG + Intergenic
932455090 2:71844375-71844397 TATGATGCCAATCTCCTCCCAGG + Intergenic
932599791 2:73115499-73115521 TGTGCTGCTACACTCCAGCCTGG + Intronic
932667764 2:73710722-73710744 CCTCCTCCCACTCTCCACCCTGG - Intergenic
932743249 2:74308014-74308036 TTTCCTCTCACTCTCCTCCCCGG - Intronic
933224949 2:79737303-79737325 TGTGCCACCACTCTCCAGCCTGG + Intronic
935261909 2:101362915-101362937 GCTCCTGCCACTCTCCACCAGGG - Intronic
935549848 2:104441346-104441368 TTTGCTTCCCCTCTCTCCCCAGG - Intergenic
936251118 2:110869195-110869217 TGTGCTCTCACTCTCAACCCTGG + Intronic
937023659 2:118680308-118680330 CTTGCTGCCACTCACCTCCCTGG + Intergenic
937973418 2:127566684-127566706 GGTGCTGCCGCTCTACACCCTGG + Exonic
937975242 2:127578247-127578269 CTGGCTGCCATTCTCCACCTGGG + Exonic
941352696 2:164455903-164455925 TTTGCTGCCACTTCCCGCTCAGG - Intergenic
942106131 2:172635685-172635707 ACTGCTGCCCCCCTCCACCCCGG + Intergenic
942226807 2:173823680-173823702 TTTGCTGCCTCTTGCCTCCCTGG - Intergenic
942509931 2:176687134-176687156 GTGGCTCCCACTCTCCATCCAGG - Intergenic
945408677 2:209483528-209483550 TTTGCCACCACACTCCAGCCTGG + Intronic
945455907 2:210052042-210052064 TGTGCCACCACTCTCCACCGTGG - Intronic
948766914 2:240227127-240227149 TTTGCTGACACCCTCCACAAGGG - Intergenic
1169053280 20:2598456-2598478 TTTGCCACTACACTCCACCCTGG - Intronic
1169510486 20:6258850-6258872 TTTGATGCCTCTCTTCTCCCTGG + Intergenic
1175325534 20:58125157-58125179 TTTGCTGCCACTCCTCAGCTTGG - Intergenic
1175737164 20:61395051-61395073 TTTGAAGCCACTCTCCTCCTGGG + Intronic
1175763439 20:61576697-61576719 ACTGCTGCCACTCAGCACCCAGG + Intronic
1175920154 20:62446835-62446857 TTTGCTCCCCATCTCAACCCTGG - Intergenic
1177273464 21:18877354-18877376 TTTCCTGCCACTCCCCAGCTGGG - Intergenic
1179720513 21:43313768-43313790 TTGGAGGCCTCTCTCCACCCAGG + Intergenic
1180021040 21:45127219-45127241 CTTCTTGACACTCTCCACCCAGG + Intronic
1182043366 22:27255538-27255560 TTTCCTACCACTCTCCCCCAAGG + Intergenic
1182476852 22:30581155-30581177 ACTGCTGCCCCTCCCCACCCTGG - Intronic
1182577753 22:31284624-31284646 TTGGCTGCCACACAACACCCAGG - Intronic
1182921825 22:34087387-34087409 TGTGCTGCCACACTCCAGCCTGG - Intergenic
1183300972 22:37059046-37059068 AATGCTGCCACCCTCCACCAGGG + Intronic
1184320923 22:43741726-43741748 TGTCCTGCCACTGTCCACTCTGG + Intronic
951481967 3:23170585-23170607 TTTGCTGCTATTGTCCATCCTGG - Intergenic
951765545 3:26194570-26194592 TATGCTGCTACACTCCAGCCTGG - Intergenic
952850919 3:37728697-37728719 TTTGTTGCCTCTCCCCACCTGGG + Intronic
953664930 3:44918566-44918588 TTTGCAGCCCCTATCTACCCTGG - Intronic
957610118 3:82454915-82454937 TTTTCTGCCATTCTACATCCAGG - Intergenic
959580984 3:107982065-107982087 TTTGCTGCCATTTGCCACTCAGG - Intergenic
959631806 3:108515222-108515244 TTAGATGCCACTCTCCATCTGGG + Intronic
960591232 3:119367811-119367833 TGTGCTGCTACACTCCAGCCTGG + Intronic
960621362 3:119639584-119639606 TGTGGTGCCACTCCCCAACCTGG - Intronic
960698680 3:120419764-120419786 CTTGCAGCCTCTCTCCATCCAGG - Intronic
961356798 3:126344575-126344597 CTGGCTGCCTCTCACCACCCTGG + Intronic
961403800 3:126665256-126665278 TTTGCTGGCATTCTCCCCTCTGG + Intergenic
961449792 3:126997525-126997547 TGTGCTGCCACTGCCCGCCCAGG + Intronic
961846252 3:129766662-129766684 TGTGCTGCTACACTCCAGCCTGG - Intronic
963392093 3:144677862-144677884 TTTTCTGCTCCTCTCCACCTGGG - Intergenic
964317216 3:155457292-155457314 TTGGCTGCCTCCCTCCTCCCTGG - Intronic
964938276 3:162122121-162122143 CTTGCTACCACACTCCAGCCTGG + Intergenic
970206046 4:13656640-13656662 TTTGCTGCTATTCGCCATCCAGG + Intergenic
972835349 4:42863576-42863598 TGTGCTGCCATTCTCCACTCTGG + Intergenic
973715557 4:53672441-53672463 TTTGTTACCACTCTCCAACATGG + Intronic
973962830 4:56129117-56129139 TATGCTACCACACTCCAGCCCGG - Intergenic
977232389 4:94467356-94467378 TATGCCGCCACACTCCAGCCTGG - Intronic
977544587 4:98362427-98362449 TGTGCTACCACACTCCAGCCTGG + Intronic
979070198 4:116193959-116193981 TGCTCTGTCACTCTCCACCCAGG - Intergenic
979139648 4:117154780-117154802 TTTGCAGGCACTCTCCTCTCTGG + Intergenic
979523862 4:121697178-121697200 TCTGCGGCCGCTCCCCACCCAGG - Intergenic
982130616 4:152225450-152225472 TTTCCTGCCTTTCTCCTCCCAGG - Intergenic
985871804 5:2563188-2563210 GTTGGTGCCACTCTCGATCCTGG + Intergenic
987249751 5:16086877-16086899 TTTGCTTCTTCACTCCACCCTGG - Intronic
987860145 5:23475226-23475248 TGTGCTGCCATACTCCAGCCTGG + Intergenic
988297917 5:29390458-29390480 TTTGCTCCCTCACTCCTCCCAGG + Intergenic
989113378 5:37928548-37928570 TTTTCTGCCCTTCTCCTCCCTGG - Intergenic
989183484 5:38600909-38600931 TTTGCTTCCAGTATCAACCCAGG - Intronic
989654683 5:43733814-43733836 TTTGCTCCCTCTCTCCATCTAGG + Intergenic
990068858 5:51753407-51753429 TGTGCCACCACTCTCCAGCCTGG + Intergenic
991294904 5:65070571-65070593 TGTGCTACCACACTCCAGCCTGG - Intergenic
991574569 5:68089609-68089631 TGTGCTGCTACACTCCAGCCTGG + Intergenic
992097644 5:73378030-73378052 TTTGCTTCCAAACTCCAACCAGG + Intergenic
992313538 5:75528765-75528787 TGTGCTGCCGCACTCCAACCTGG + Intronic
992626980 5:78645131-78645153 TTGCCTTCCACTCTCCAGCCTGG - Intronic
995639361 5:114236631-114236653 TTTGCTGCCCCCCTTCATCCAGG + Intergenic
997383173 5:133451849-133451871 TTTGCTGTACCTCTCCACCAAGG + Intronic
998106519 5:139472510-139472532 CTCTCTGCCACTCTCCTCCCAGG + Intergenic
998206049 5:140157548-140157570 TTTCCTGCCACTCTCATCTCCGG + Intergenic
998211264 5:140200533-140200555 TTTCCTTCCACTCTTCCCCCCGG + Intronic
998305341 5:141070601-141070623 TTTGAGCCCACTCTCCTCCCTGG - Intergenic
998437257 5:142122186-142122208 TTTCCAGTCACTCTCCTCCCGGG + Intronic
999330969 5:150673045-150673067 TTCACTGCCACTCTCCACTTTGG - Intronic
1000974610 5:167751105-167751127 CCTGCTTCCTCTCTCCACCCTGG - Intronic
1001033562 5:168280444-168280466 TCTGCTGCTGCTCTCCAGCCTGG + Intergenic
1001763554 5:174226791-174226813 TTTCCTCCCACTCCCAACCCGGG + Intronic
1001979481 5:176029215-176029237 TGTGCTGCTACACTCCAGCCTGG + Intronic
1002237935 5:177814546-177814568 TGTGCTGCTACACTCCAGCCTGG - Intergenic
1003012932 6:2443075-2443097 TGTGCTGCCACACTCCAGGCTGG - Intergenic
1003618167 6:7673724-7673746 TTTCCTTCCACTCTTCACCTAGG + Intergenic
1004957575 6:20746991-20747013 TTTTCTCCCCCTCCCCACCCCGG + Intronic
1006502454 6:34467153-34467175 TTTGCTTCCATCCTCCATCCTGG + Intronic
1006751213 6:36378826-36378848 TTTGCTGCTCCTTTCCCCCCGGG - Intronic
1007639015 6:43321821-43321843 TATGCTACCACACTCCAGCCTGG - Intronic
1008130986 6:47720167-47720189 GGTGCTGCCACCCTCCACTCTGG - Intronic
1009714617 6:67374644-67374666 TTTCCTGCCACTCTCCAAGAGGG + Intergenic
1010404353 6:75486121-75486143 TGTGCTGCCAGTCTCTACCTTGG - Intronic
1015178744 6:130339088-130339110 TGTGCTGCTACACTCCAGCCTGG - Intronic
1015210400 6:130691162-130691184 TTTGCTGGCATTCTCCTCCCTGG - Intergenic
1015350444 6:132211182-132211204 TTTGCTAGCATTCTCCTCCCTGG + Intergenic
1015769689 6:136755643-136755665 CTTGCTACCACACTCCAGCCTGG + Intronic
1019517348 7:1445894-1445916 CTTGCTGCCACCCTGCACCCCGG - Intronic
1019985697 7:4653986-4654008 CGTGCTGCCACACTCCAGCCTGG - Intergenic
1020066200 7:5190297-5190319 GTCGCCGCCACTCGCCACCCTGG - Exonic
1022451581 7:30520810-30520832 CTTCCTGCCTCTCTCCACTCTGG - Intronic
1023289892 7:38657837-38657859 TGTGCTACCACCCTCCAGCCTGG - Intergenic
1024466246 7:49714125-49714147 TTTGCTTCCCCTCTCCCCACTGG - Intergenic
1024882361 7:54102614-54102636 TTTGCTGCCACTCCTCTCTCTGG + Intergenic
1024991822 7:55240770-55240792 TTTGCTCCCACTGACCACCTGGG + Intronic
1026920004 7:74148399-74148421 TGTTCTGCCACACTCCAGCCTGG + Intergenic
1026942798 7:74297431-74297453 TGTGCTACCACCCTCCAGCCTGG + Intronic
1028510775 7:91624038-91624060 CTTGCTGCTGCACTCCACCCTGG - Intergenic
1029464640 7:100717576-100717598 TTTGCTACTGCACTCCACCCTGG - Intergenic
1029729254 7:102428793-102428815 TGTGCTGCCGCACTCCAGCCTGG + Intergenic
1030211618 7:107002015-107002037 TTTGCTGCTGCACTCCAGCCTGG + Intergenic
1031024281 7:116663201-116663223 TTTCCTGCCACTGTCTGCCCTGG + Intergenic
1032338122 7:131044970-131044992 CATGCTGCCACCCTACACCCAGG + Intergenic
1032869854 7:135973213-135973235 TTTGCTGCTTCTTTCCAGCCTGG + Intronic
1033169989 7:139075474-139075496 TGTGCTACCACACTCCAGCCTGG - Intronic
1035302357 7:157905986-157906008 AACGCTGCCACTTTCCACCCAGG + Intronic
1035861981 8:3039063-3039085 TTTGCTCCCACTCTGCTGCCTGG - Intronic
1035954612 8:4062327-4062349 TCTTCTGCCACTCTCCACCCTGG - Intronic
1036460041 8:8944227-8944249 TTTGCTGCCAGCCTGAACCCTGG + Intergenic
1037827357 8:22167397-22167419 TTTCCTGCCCCTCTGCAGCCTGG + Intronic
1044528510 8:93279740-93279762 TTTGCTGGCATTCTCAACACGGG + Intergenic
1047023043 8:120796713-120796735 TTTGCATCCACTTTCCGCCCTGG + Intronic
1048338724 8:133522800-133522822 TTTGCCACCACTATCCTCCCTGG + Intronic
1048953407 8:139514521-139514543 TTTGCTGCCTCTCTCCTTCCTGG + Intergenic
1049583390 8:143422585-143422607 CTTGCTGCCCCTTTCAACCCTGG - Intronic
1049708562 8:144053726-144053748 TCTGCCACCACCCTCCACCCTGG + Intronic
1049800475 8:144515347-144515369 CGTGCTGCCACTCTACTCCCTGG - Exonic
1050773363 9:9231923-9231945 GTTTCTGTCACTCTCCATCCAGG + Intronic
1053136677 9:35655223-35655245 TATACAGCCACTCTCCATCCTGG - Intergenic
1054881043 9:70145258-70145280 TTTGCTTCCTCTCTCCTCCAGGG - Intronic
1056019284 9:82424463-82424485 TCCCCTGCCACTCTTCACCCAGG + Intergenic
1056038740 9:82637590-82637612 TATACTGCCACTGCCCACCCTGG + Intergenic
1057589153 9:96356829-96356851 TGTGCTACCACACTCCAGCCTGG + Intronic
1057783632 9:98070846-98070868 TGTGCTGCTACTCTCCAGCCTGG - Intronic
1058435786 9:104961899-104961921 TTTGCTGCAGCTCTACACCATGG + Intergenic
1061375746 9:130223246-130223268 TTTGCTGCCAACCTCCTCCATGG + Intronic
1061428002 9:130512874-130512896 TATGCAGCCCCTCTCCACCTGGG + Intergenic
1186054250 X:5632171-5632193 ATTGCTGCCACAGTCCTCCCTGG + Intergenic
1186128401 X:6440777-6440799 TGTGCCACCACACTCCACCCTGG + Intergenic
1186144511 X:6611340-6611362 TGAGCTGCCACTCTCTGCCCAGG + Intergenic
1186460797 X:9746984-9747006 TTTTCTGCCACTTTCCCCTCTGG - Intronic
1187592694 X:20735722-20735744 TTTTCTCCCACTCTCCACTCTGG + Intergenic
1189169717 X:38897456-38897478 TTTTCTGCCACCAACCACCCTGG - Intergenic
1190432661 X:50392814-50392836 TTTCCTGCCACTCTCTTTCCCGG - Intronic
1190909291 X:54757261-54757283 TTTACTCCCACTCTGCCCCCTGG - Exonic
1192166593 X:68830658-68830680 TCGGCCGCCACTCTCCGCCCTGG - Intronic
1192461338 X:71319873-71319895 TTTTCTACCACACTCCAGCCTGG - Intergenic
1195023231 X:100850098-100850120 TTTTCTGCCAGTCTGCATCCTGG + Intronic
1195048777 X:101078617-101078639 TTTGCTGCCACCTTCCCACCGGG - Intergenic
1197244220 X:124151477-124151499 TTTGCTGTCAACCTCCAACCAGG - Intronic
1198333768 X:135646641-135646663 TGTGCTACCACACTCCAGCCTGG - Intergenic
1198524483 X:137486990-137487012 TGTGCCACCACACTCCACCCTGG + Intergenic
1200865940 Y:8043394-8043416 TTTGCTGTAACTCTCTAGCCAGG + Intergenic
1201343535 Y:12958492-12958514 TGGGCTGCCACACTCCAGCCTGG + Intergenic
1201433225 Y:13927502-13927524 TTTGCAGCGATTCACCACCCTGG + Intergenic