ID: 1076122038

View in Genome Browser
Species Human (GRCh38)
Location 10:127944123-127944145
Sequence GCAAATCATGGTTCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076122029_1076122038 20 Left 1076122029 10:127944080-127944102 CCAATGGCCAAGCTTTGACTTTC No data
Right 1076122038 10:127944123-127944145 GCAAATCATGGTTCTGCTGCTGG No data
1076122036_1076122038 -5 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA No data
Right 1076122038 10:127944123-127944145 GCAAATCATGGTTCTGCTGCTGG No data
1076122031_1076122038 13 Left 1076122031 10:127944087-127944109 CCAAGCTTTGACTTTCGGCCAGG No data
Right 1076122038 10:127944123-127944145 GCAAATCATGGTTCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076122038 Original CRISPR GCAAATCATGGTTCTGCTGC TGG Intronic