ID: 1076122039

View in Genome Browser
Species Human (GRCh38)
Location 10:127944127-127944149
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076122029_1076122039 24 Left 1076122029 10:127944080-127944102 CCAATGGCCAAGCTTTGACTTTC No data
Right 1076122039 10:127944127-127944149 ATCATGGTTCTGCTGCTGGAAGG No data
1076122036_1076122039 -1 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA No data
Right 1076122039 10:127944127-127944149 ATCATGGTTCTGCTGCTGGAAGG No data
1076122031_1076122039 17 Left 1076122031 10:127944087-127944109 CCAAGCTTTGACTTTCGGCCAGG No data
Right 1076122039 10:127944127-127944149 ATCATGGTTCTGCTGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type