ID: 1076122040

View in Genome Browser
Species Human (GRCh38)
Location 10:127944140-127944162
Sequence TGCTGGAAGGACTGAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076122036_1076122040 12 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA No data
Right 1076122040 10:127944140-127944162 TGCTGGAAGGACTGAAGTCCAGG No data
1076122031_1076122040 30 Left 1076122031 10:127944087-127944109 CCAAGCTTTGACTTTCGGCCAGG No data
Right 1076122040 10:127944140-127944162 TGCTGGAAGGACTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076122040 Original CRISPR TGCTGGAAGGACTGAAGTCC AGG Intronic