ID: 1076122041

View in Genome Browser
Species Human (GRCh38)
Location 10:127944141-127944163
Sequence GCTGGAAGGACTGAAGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076122036_1076122041 13 Left 1076122036 10:127944105-127944127 CCAGGGTGGAGAGTGGCAGCAAA No data
Right 1076122041 10:127944141-127944163 GCTGGAAGGACTGAAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076122041 Original CRISPR GCTGGAAGGACTGAAGTCCA GGG Intronic