ID: 1076124083

View in Genome Browser
Species Human (GRCh38)
Location 10:127961085-127961107
Sequence TTCAGACGATGCCAAGGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076124076_1076124083 11 Left 1076124076 10:127961051-127961073 CCCACTCACCCTTCCTCTCTGCT 0: 1
1: 1
2: 8
3: 80
4: 925
Right 1076124083 10:127961085-127961107 TTCAGACGATGCCAAGGAACGGG No data
1076124077_1076124083 10 Left 1076124077 10:127961052-127961074 CCACTCACCCTTCCTCTCTGCTG 0: 1
1: 1
2: 9
3: 158
4: 1760
Right 1076124083 10:127961085-127961107 TTCAGACGATGCCAAGGAACGGG No data
1076124080_1076124083 -2 Left 1076124080 10:127961064-127961086 CCTCTCTGCTGTTAGTGTGCATT 0: 1
1: 0
2: 3
3: 26
4: 236
Right 1076124083 10:127961085-127961107 TTCAGACGATGCCAAGGAACGGG No data
1076124079_1076124083 2 Left 1076124079 10:127961060-127961082 CCTTCCTCTCTGCTGTTAGTGTG 0: 1
1: 0
2: 6
3: 22
4: 302
Right 1076124083 10:127961085-127961107 TTCAGACGATGCCAAGGAACGGG No data
1076124078_1076124083 3 Left 1076124078 10:127961059-127961081 CCCTTCCTCTCTGCTGTTAGTGT 0: 1
1: 0
2: 4
3: 33
4: 422
Right 1076124083 10:127961085-127961107 TTCAGACGATGCCAAGGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076124083 Original CRISPR TTCAGACGATGCCAAGGAAC GGG Intronic
No off target data available for this crispr