ID: 1076124574

View in Genome Browser
Species Human (GRCh38)
Location 10:127963649-127963671
Sequence TCCACCCCAGGTGAGATCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076124574 Original CRISPR TCCACCCCAGGTGAGATCGG AGG (reversed) Intronic
902772697 1:18654923-18654945 GCCACCCCAGGGGTGATAGGAGG - Intronic
904708199 1:32407922-32407944 TCCAACCCAGGCGACATGGGAGG - Intergenic
906359251 1:45138710-45138732 CCCTCCCCAGGGGAGATCAGGGG + Intronic
907247632 1:53118044-53118066 GCCACCGCAGGTGAGGGCGGAGG + Intronic
908896163 1:68902595-68902617 TTCACCCCAGGTGAGTCCGTTGG + Intergenic
910122581 1:83806910-83806932 TCCACAGCATGTGAGATTGGTGG - Intergenic
913105904 1:115613790-115613812 TCCACCCCAGGTGCTATGTGGGG - Intergenic
916324306 1:163540204-163540226 TCCACCCCAGCTCAGGTTGGTGG - Intergenic
917614919 1:176732957-176732979 TCCACCTCTTGTCAGATCGGTGG + Intronic
920178380 1:204117393-204117415 TCCTCCCCAGCTGAGACCTGAGG + Intronic
920532802 1:206716559-206716581 TCCACCCCCTGTGAGATCTGTGG + Intronic
921891255 1:220356094-220356116 TCCGCCTCTGGTGAGATCAGCGG - Intergenic
922381713 1:225036164-225036186 TCCATCCCAGGTGAGAGTGTGGG - Intronic
1063367167 10:5498606-5498628 GCCACCGCAGGTGAGAGGGGTGG + Intergenic
1064395540 10:14979108-14979130 TACACCCCATGTGACATAGGAGG - Intronic
1064396325 10:14984797-14984819 TCCACCCCGTGTGACATCAGGGG - Intronic
1067164043 10:43851193-43851215 TCCACCCCCTGTCAGATCAGTGG - Intergenic
1076124574 10:127963649-127963671 TCCACCCCAGGTGAGATCGGAGG - Intronic
1077351991 11:2097296-2097318 TCTTCCCGAGGGGAGATCGGGGG - Intergenic
1079256151 11:18832872-18832894 TACAACCCAGGAGAGATTGGGGG - Intergenic
1081176517 11:39933669-39933691 TCCACCCCCTGTCAGATCAGTGG - Intergenic
1081589370 11:44410329-44410351 TCCACTGCAGGTGAGAACAGAGG + Intergenic
1083962368 11:66021465-66021487 CCCACCCCAGGTGGGAGCCGTGG + Intronic
1085828465 11:79873437-79873459 TCCACCCCAGGCCAGATAGTGGG + Intergenic
1096259293 12:50081092-50081114 GCCCCCGCAGGTGACATCGGGGG + Exonic
1099306728 12:80966220-80966242 TCCACCCCCTGTCAGATCAGTGG + Intronic
1103925907 12:124423250-124423272 TCCACCCCAGGGGTGCTGGGTGG + Intronic
1103945870 12:124526235-124526257 TCCACCCCAGGTGACAGTGAGGG + Intronic
1108464257 13:50698428-50698450 TCCCCCACAGGTGACATCTGTGG - Intronic
1109980336 13:69898340-69898362 TGCACCCCAGAGGAGATCAGAGG + Intronic
1112616024 13:101006402-101006424 TCCACCTCCTGTGAGATCAGTGG - Intergenic
1117812395 14:59562008-59562030 GCCACGCCAGGTGAGAGAGGTGG + Intronic
1121801442 14:96777570-96777592 TCCAGCCCAGGTGAAAGGGGAGG + Intergenic
1122356961 14:101128807-101128829 TCTACCGCAGGTGGGATGGGAGG - Intergenic
1130639295 15:85655778-85655800 ACCACCGGAGGTGAGATGGGAGG + Exonic
1130991804 15:88880049-88880071 TCCGGCCCTGGTGAGATCGGAGG - Intronic
1132863835 16:2084164-2084186 TCAACCCCAGGTGGGCTCGAGGG + Intronic
1135889969 16:26348299-26348321 TCCGCCCCCTGTGAGATCAGCGG - Intergenic
1135910537 16:26556671-26556693 TCTTCCCCAGGTGAGATTAGAGG + Intergenic
1138774871 16:59709103-59709125 TCCACCTCATGTCAGATCAGCGG - Intergenic
1139430432 16:66908262-66908284 TCCACCCCAGGGCAGATGGAGGG + Exonic
1140895357 16:79319994-79320016 TCCAGCCCAGGTGATATCCATGG + Intergenic
1142882897 17:2895230-2895252 ACCACCCCAGGTGCCCTCGGGGG + Intronic
1144838022 17:18167736-18167758 TCCACCCCAGCTGAGGCAGGAGG - Intronic
1157222414 18:45837544-45837566 GCCACCCGAGGTGAGCGCGGAGG + Exonic
1159524389 18:69568738-69568760 TCCACCTCCTGTCAGATCGGTGG + Intronic
1161120306 19:2522038-2522060 TCATCCCCAGATGAGATCTGGGG - Intronic
1164403362 19:27919038-27919060 TCCTCCCCAGGTGAGGGCTGTGG + Intergenic
925575702 2:5357794-5357816 TCTACCACAGGTGAGGTGGGAGG + Intergenic
925993236 2:9270272-9270294 TCCACTCCAGCTCAGAGCGGGGG - Intronic
927571877 2:24167178-24167200 TCCAGGCCAGGTGAGAGCGAGGG + Intronic
933918959 2:87025565-87025587 TCCACTTCAGGTGAGATGGAAGG - Intergenic
934004035 2:87744349-87744371 TCCACTTCAGGTGAGATGGAAGG + Intergenic
939697116 2:145340338-145340360 TCCAGCCCAGGAGAGATAGCTGG - Intergenic
940535150 2:154931721-154931743 TCCACCTCATGTAAGATCAGTGG - Intergenic
942502611 2:176607440-176607462 TCCACCTCCTGTGAGATCAGTGG - Intergenic
947052564 2:226062717-226062739 TCCACCTTAGGTGGGATAGGTGG - Intergenic
947703474 2:232255356-232255378 TCAACTCCAGGTGAGACTGGTGG - Intronic
1172656505 20:36541552-36541574 TCCGCACCAGGTGGGATCCGGGG + Exonic
1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG + Intronic
1175852021 20:62098763-62098785 TCCAGCCCAGGTGACAGTGGAGG + Intergenic
1176179740 20:63743616-63743638 GCCACCCCAGGCGAGGCCGGAGG + Intergenic
1178341667 21:31790664-31790686 TCCACCTCCTGTCAGATCGGTGG - Intergenic
1179036246 21:37760800-37760822 CCCAGCCCAGGTGAGACAGGAGG - Intronic
1180173925 21:46078389-46078411 TCCACACCAGGTGAGACGGGGGG + Intergenic
1180733216 22:17997536-17997558 ACCACCCCAGGTCTGATGGGAGG - Intronic
1181517934 22:23426697-23426719 ACCACCCCAGGTCTGATGGGAGG - Intergenic
1182692499 22:32173868-32173890 ACCACCCCAGGTGCCCTCGGGGG + Intergenic
1183032045 22:35113714-35113736 TCCACCCAAGGTGTGCTCAGCGG - Intergenic
1185359054 22:50394252-50394274 TCCACCCCATGTGAGAAGTGAGG + Intronic
954910623 3:54104273-54104295 TCCACCTCCTGTCAGATCGGCGG + Intergenic
961271109 3:125689464-125689486 TACACCCCATGTGACATAGGAGG + Intergenic
967089373 3:186122216-186122238 TCCACACCAGGTGTGAGTGGGGG + Intronic
967327921 3:188260699-188260721 TCCATCCCAGATGAAATCAGAGG + Intronic
968589109 4:1448947-1448969 GCAACCCCAGGTGGGATAGGAGG - Intergenic
971231232 4:24801238-24801260 ACCAGCCCAGGTGAGATGGAAGG - Intergenic
973300338 4:48575365-48575387 TACACCCCAGGTGAAATTTGAGG - Intronic
980296248 4:130921997-130922019 TACAAGCCAGGAGAGATCGGAGG - Intergenic
984710240 4:182878828-182878850 TCCACCCCACGTGACATGGTGGG - Intergenic
988069117 5:26264865-26264887 TCCAAGCCAGGAGAGATTGGTGG - Intergenic
988126961 5:27053246-27053268 TCCACCCTAGGAGAGAGCAGTGG - Intronic
992564161 5:77981565-77981587 TCCACCTCCTGTCAGATCGGTGG - Intergenic
994938236 5:106284526-106284548 TCCACCCCCTGTCAGATCAGTGG - Intergenic
995383500 5:111563221-111563243 TCCACCCCAGGTAACATCTGAGG + Intergenic
1001093579 5:168759640-168759662 TCGACCCCAGCTGAGAACGTGGG + Intronic
1002054084 5:176588957-176588979 TCCACCCCAGCAGGGATCAGAGG - Intronic
1006019659 6:31110618-31110640 GCCACCCCAGGTGGGATTGTTGG + Intergenic
1007575910 6:42925194-42925216 CCTACCCCAGGAGAGAACGGCGG - Intronic
1017543114 6:155423212-155423234 TCCACCCCAGCTGCCATCAGAGG + Intronic
1018127823 6:160698491-160698513 TCCACTTCAGGTGAGATGGAAGG + Intergenic
1019119497 6:169792019-169792041 CCCACCCCCGCTGAGACCGGCGG + Intergenic
1024711015 7:52014653-52014675 GCCTCCCCAGGTGAGCTGGGTGG - Intergenic
1026053484 7:66965941-66965963 TCCACCCCCTGTCAGATCAGTGG - Intergenic
1029643459 7:101836272-101836294 TGCACCCCAGGAGAAATCTGAGG - Intronic
1034935171 7:155194651-155194673 TCCACCCCTAGTGAGGGCGGAGG - Intergenic
1035103291 7:156418921-156418943 TCCACCCCAGGTAATTTCAGCGG - Intergenic
1045006653 8:97921958-97921980 TCCACCTCCTGTGAGATCAGTGG + Intronic
1048140075 8:131785752-131785774 TCCACCTCCTGTCAGATCGGTGG - Intergenic
1051261740 9:15271581-15271603 TCCACCCCGTGTTAGATCAGCGG - Intronic
1061450985 9:130666885-130666907 TCCACCCGGGCTGAGAGCGGCGG + Intronic
1062038005 9:134391249-134391271 TCCACCACAGGTGGGACCTGAGG + Intronic
1189114884 X:38332034-38332056 TCCACCCCCTGTCAGATCAGTGG + Intronic
1194818395 X:98474042-98474064 TCCACCTCCTGTGAGATCAGTGG + Intergenic
1200802563 Y:7399776-7399798 TCCACCCCAGAGGAGATGTGTGG + Intergenic
1200941020 Y:8781883-8781905 TCCACCCTAGGTGACAGCGCAGG + Intergenic
1201889677 Y:18928349-18928371 TCCAGCCCAGGTGACAGAGGAGG + Intergenic