ID: 1076135647

View in Genome Browser
Species Human (GRCh38)
Location 10:128044280-128044302
Sequence TCTAGGGCCCCTGGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076135635_1076135647 24 Left 1076135635 10:128044233-128044255 CCTGTCCTTGAGTGAGCCACATC 0: 1
1: 0
2: 1
3: 14
4: 228
Right 1076135647 10:128044280-128044302 TCTAGGGCCCCTGGGGAAGGAGG No data
1076135638_1076135647 8 Left 1076135638 10:128044249-128044271 CCACATCTTTTCAGTATGGACTT 0: 1
1: 0
2: 1
3: 15
4: 192
Right 1076135647 10:128044280-128044302 TCTAGGGCCCCTGGGGAAGGAGG No data
1076135636_1076135647 19 Left 1076135636 10:128044238-128044260 CCTTGAGTGAGCCACATCTTTTC 0: 1
1: 0
2: 5
3: 14
4: 202
Right 1076135647 10:128044280-128044302 TCTAGGGCCCCTGGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076135647 Original CRISPR TCTAGGGCCCCTGGGGAAGG AGG Intronic
No off target data available for this crispr