ID: 1076135766

View in Genome Browser
Species Human (GRCh38)
Location 10:128045052-128045074
Sequence TGGCCTCCCCACACCACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076135751_1076135766 24 Left 1076135751 10:128045005-128045027 CCATCCCTGCAGGCAGGACATGG 0: 1
1: 1
2: 0
3: 36
4: 364
Right 1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG No data
1076135758_1076135766 -4 Left 1076135758 10:128045033-128045055 CCCAACTCTCGCCCCCACCTGGC 0: 1
1: 0
2: 1
3: 26
4: 243
Right 1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG No data
1076135755_1076135766 20 Left 1076135755 10:128045009-128045031 CCCTGCAGGCAGGACATGGGGAG 0: 1
1: 0
2: 3
3: 39
4: 322
Right 1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG No data
1076135759_1076135766 -5 Left 1076135759 10:128045034-128045056 CCAACTCTCGCCCCCACCTGGCC 0: 1
1: 0
2: 1
3: 32
4: 382
Right 1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG No data
1076135756_1076135766 19 Left 1076135756 10:128045010-128045032 CCTGCAGGCAGGACATGGGGAGT 0: 1
1: 0
2: 4
3: 25
4: 238
Right 1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076135766 Original CRISPR TGGCCTCCCCACACCACCCA GGG Intronic
No off target data available for this crispr