ID: 1076136626

View in Genome Browser
Species Human (GRCh38)
Location 10:128049588-128049610
Sequence CATCCCCGTGGAGCACCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076136620_1076136626 -6 Left 1076136620 10:128049571-128049593 CCCAAGAAGTATTTTCCCATCCC 0: 1
1: 0
2: 5
3: 36
4: 421
Right 1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 132
1076136618_1076136626 3 Left 1076136618 10:128049562-128049584 CCCTCAGGGCCCAAGAAGTATTT 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 132
1076136619_1076136626 2 Left 1076136619 10:128049563-128049585 CCTCAGGGCCCAAGAAGTATTTT 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 132
1076136621_1076136626 -7 Left 1076136621 10:128049572-128049594 CCAAGAAGTATTTTCCCATCCCC 0: 1
1: 0
2: 2
3: 23
4: 227
Right 1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076136626 Original CRISPR CATCCCCGTGGAGCACCTGG AGG Exonic
900374491 1:2347212-2347234 CGTCCCCTTGGGGCAGCTGGTGG + Intronic
900656308 1:3759949-3759971 GAGCCCCTTGGAGCTCCTGGAGG - Intronic
901167114 1:7229040-7229062 CATCTCCCTGGAGCAGGTGGAGG + Intronic
902242748 1:15099749-15099771 CATCCCCCAGGACCACCAGGGGG - Intronic
906322557 1:44826294-44826316 CATCCCCGTGGTGATCCTTGTGG - Exonic
907388779 1:54142827-54142849 CAGCCCCCTGGAGCACCTGCTGG + Intronic
914808528 1:151009098-151009120 CACCCCCGAGGTTCACCTGGAGG - Intronic
915553996 1:156651336-156651358 CTTCCCTGTGGAGCACCTACTGG - Intronic
919568588 1:199219176-199219198 CATTCCCCTGGAGCCACTGGGGG + Intergenic
920328600 1:205187492-205187514 CATCCCTGAGGAGGATCTGGAGG - Exonic
922744704 1:228037475-228037497 CACCCCCGAGGGGCTCCTGGGGG - Intronic
923041892 1:230325574-230325596 AATCCCTCTGAAGCACCTGGTGG - Intronic
1063368268 10:5504592-5504614 CACACACGTGGAGCACGTGGGGG - Intergenic
1067060703 10:43076771-43076793 CATCCCCGCCGCGCACCTCGGGG + Intergenic
1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG + Exonic
1077206881 11:1349069-1349091 CATCCCCGGGGAGCTCCGGGTGG - Intergenic
1077485881 11:2838265-2838287 CATGCCCGTCAGGCACCTGGAGG + Intronic
1080282618 11:30575786-30575808 CACTCCCGTGGAGTAACTGGAGG + Intronic
1082812619 11:57487631-57487653 CATTCCCATGGAGCAGGTGGCGG + Intronic
1084396567 11:68914846-68914868 CATCGCCGTGGACAATCTGGTGG + Exonic
1084412792 11:69013911-69013933 CTTCCCCATTGAGCCCCTGGAGG + Intergenic
1084793548 11:71489929-71489951 GAGTCCCGTGGAGAACCTGGAGG + Intronic
1084891281 11:72238266-72238288 CATCACCGAGGAGGACTTGGAGG + Exonic
1089462909 11:118663125-118663147 CATCCCCAGGGAGCAGCTGCAGG - Exonic
1090264015 11:125342821-125342843 CACCACCGTGGAGGAGCTGGAGG + Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1096482614 12:51952218-51952240 CGCCCCCCAGGAGCACCTGGAGG - Intronic
1102603520 12:114051444-114051466 CATCCACCTGGCCCACCTGGAGG + Intergenic
1104834179 12:131776676-131776698 TCTCCCCGGGGAGCAGCTGGGGG + Intronic
1104958305 12:132476517-132476539 CATCTCCTCGGAGCCCCTGGCGG + Intergenic
1105440019 13:20407302-20407324 CCTGCCCTTGGAGCACCCGGAGG - Intronic
1105475211 13:20722650-20722672 CATCCCTTTGGTCCACCTGGAGG - Exonic
1110716269 13:78708031-78708053 CAGCAACGTGGAGCAGCTGGAGG - Intergenic
1112953945 13:105036477-105036499 CATCCCTGTGTAGGAGCTGGTGG - Intergenic
1114182504 14:20378227-20378249 CCTCCCTGTGTAGGACCTGGGGG - Exonic
1121224563 14:92311869-92311891 CATCCCCATAGGGCACCTGCTGG - Intergenic
1121671909 14:95716640-95716662 CATGCCCGTGAATCACCTGGGGG - Intergenic
1202905466 14_GL000194v1_random:68962-68984 CCTGCCTGTGGAGCACCTCGGGG + Intergenic
1129779805 15:78263359-78263381 CACCCCCATGGAACACATGGAGG + Intergenic
1130444815 15:83990936-83990958 CATCCCCACGGTGCACCTTGAGG + Intronic
1133020596 16:2965144-2965166 CAGCCTCCTGGAGAACCTGGGGG + Intronic
1136564328 16:31061103-31061125 CACACCCCTGGAGCCCCTGGTGG - Exonic
1139921943 16:70466176-70466198 CCTCCCCGTGGAGAACCCCGAGG + Exonic
1142473333 17:175648-175670 CAGCTCCTGGGAGCACCTGGAGG - Intronic
1142639988 17:1280193-1280215 CATCTCCGAGGGGCACCTGGAGG + Exonic
1143200774 17:5111760-5111782 CTTCCCCGAGGTCCACCTGGCGG - Intronic
1143626943 17:8115792-8115814 CATCCCTGTGAAACACGTGGCGG + Intronic
1146400796 17:32498490-32498512 AGTCCTTGTGGAGCACCTGGAGG - Intronic
1150249122 17:63696506-63696528 CACCCCAGTGGAGCTCCTGGAGG - Exonic
1151732947 17:75921744-75921766 CATCCCCGTGTCCCACCTAGAGG - Intronic
1152145282 17:78564594-78564616 CTTCCACGTGGAGCCCCTGAAGG - Intronic
1152656895 17:81524021-81524043 CTTCCCCTTGGAGCACCAGACGG + Intergenic
1152809411 17:82374450-82374472 CAGCTCCCTGGAGGACCTGGTGG + Exonic
1152870274 17:82750455-82750477 GATCCCCGTGGAGCAACGCGGGG - Exonic
1160766954 19:812938-812960 CCACCCCGTGGTGCACCTGTCGG - Exonic
1161029903 19:2052771-2052793 CATCCTCCTAGAGCACTTGGAGG - Intergenic
1161325582 19:3662124-3662146 CAGCCCCGGGGACCACCAGGAGG - Intronic
1161580392 19:5077630-5077652 CTTCCCCGTGGAAGAGCTGGAGG - Intronic
1162966427 19:14158337-14158359 CTTCACCGTGGCCCACCTGGAGG - Exonic
1163211937 19:15847286-15847308 CAGCCCAGTGGAACACCTGCCGG - Intergenic
1163472495 19:17505639-17505661 CATCTCCATGGAGCTCCTGCTGG + Exonic
1163769567 19:19182664-19182686 CAGCGCCGTGAAGAACCTGGTGG - Exonic
1164888632 19:31804503-31804525 CATCCCAGTGCATGACCTGGAGG + Intergenic
1165503718 19:36210873-36210895 CATCAACGTGGAACACCTTGTGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166509247 19:43393313-43393335 CCTCCCCGTGGAGCAGCTCAGGG - Intergenic
1167494220 19:49808580-49808602 CTTCACCGTGGAGCCCTTGGGGG - Exonic
1167501667 19:49851640-49851662 TTCCCCCGTGGAGCACCCGGTGG + Intronic
1168685571 19:58347356-58347378 CGACCCTGTGGAGCTCCTGGTGG - Exonic
927486833 2:23494397-23494419 CATCTCCGTGGAGGAGCTGCTGG - Intronic
928130083 2:28642920-28642942 CAGCCCAGTAGAGCACCTCGGGG - Exonic
930802180 2:55454299-55454321 CATGCACTGGGAGCACCTGGAGG + Intergenic
931461986 2:62457367-62457389 CCTCCCCGTCGCGGACCTGGAGG + Intergenic
932972138 2:76556904-76556926 CTCCCCAGTGCAGCACCTGGTGG - Intergenic
934696649 2:96405017-96405039 CAGCCCCCTGGAGCACAGGGAGG + Intergenic
934905446 2:98197263-98197285 CTTCCCAGTGGATCACCTGAAGG + Intronic
935094826 2:99934449-99934471 CAGCACCGTGGAGGCCCTGGAGG - Intronic
937195825 2:120155873-120155895 CATCCCCTTGGAGTCGCTGGGGG - Intronic
937378550 2:121354873-121354895 CAACCCCGAAGAGCACCAGGAGG - Intronic
940019441 2:149141314-149141336 CATCCGCGTGGAGTACAGGGGGG + Intronic
948008023 2:234626763-234626785 CACCCTCATGGTGCACCTGGTGG - Intergenic
948450716 2:238069440-238069462 GCTGCCCCTGGAGCACCTGGTGG + Exonic
1171892358 20:30728304-30728326 CCTGCCTGTGGAGCACCTCGGGG - Intergenic
1174281800 20:49445079-49445101 CATCCCCGGGGCCCATCTGGGGG + Intronic
1175565956 20:59977119-59977141 CATCCCCGCGGAAGCCCTGGAGG - Intronic
1176371134 21:6061890-6061912 CTTCCCCTTGGAGCATCTGGAGG + Intergenic
1176624837 21:9083721-9083743 CCTGCCTGTGGAGCACCTCGGGG + Intergenic
1179499708 21:41800302-41800324 CAACCCGGAGGAGCCCCTGGGGG + Intronic
1179752385 21:43476651-43476673 CTTCCCCTTGGAGCATCTGGAGG - Intergenic
1180092797 21:45541675-45541697 CTTCCCCTTGGAGCAGCTGTGGG - Intronic
1180611665 22:17102158-17102180 CATCACCGTGGAGACCCTGGAGG + Exonic
1181139822 22:20796244-20796266 CATCCAAGACGAGCACCTGGTGG - Exonic
1181855705 22:25780128-25780150 CATCACCATGGAGAACCGGGTGG - Exonic
1183105276 22:35610883-35610905 GATCCCCGTGAAGTACCTGGAGG - Exonic
1185082486 22:48717735-48717757 CACCCCCGTGTGGCTCCTGGAGG - Intronic
950519476 3:13488136-13488158 TAGCTCCATGGAGCACCTGGAGG + Intronic
950964854 3:17139025-17139047 CCTCCCTGGGGAGCTCCTGGAGG + Intergenic
956860138 3:73314660-73314682 CTTCCCCCTAGATCACCTGGGGG - Intergenic
962318054 3:134371018-134371040 GATCCCCGTGGGGCCCCGGGAGG - Exonic
962411775 3:135147099-135147121 CATCTCTCTGCAGCACCTGGAGG + Intronic
962756551 3:138469345-138469367 CAACCCCCAGGAGCATCTGGGGG - Intronic
963078248 3:141368024-141368046 CATCCCCGGGCAGCTCCTGGTGG - Intronic
968503836 4:963038-963060 GATCCCCGTGGAGCTCCTGCCGG + Intronic
969183108 4:5456883-5456905 CATCCCCTTGCACCACGTGGAGG - Exonic
969343333 4:6556098-6556120 CATCCGCATGGGGCACGTGGGGG + Intronic
970989053 4:22191714-22191736 CAGCCCCATGGAGCATCTAGGGG - Intergenic
971103514 4:23496637-23496659 GCTCCCCATGGAGCACCTTGTGG + Intergenic
974307013 4:60155751-60155773 CATCCCAGTGGGGCCCTTGGCGG + Intergenic
978854730 4:113381520-113381542 CATTGACTTGGAGCACCTGGAGG + Exonic
984853539 4:184173924-184173946 CATCCCGGGGGGACACCTGGTGG + Intronic
985960901 5:3302592-3302614 CATCCCCCAGGGGGACCTGGAGG - Intergenic
985973229 5:3393526-3393548 CACCCCCTTGCAGCACCAGGAGG - Intergenic
993959612 5:94280809-94280831 CAAACCTGTGGAGCAGCTGGTGG - Intronic
996017540 5:118557270-118557292 CATCCCCATTCAGCACCTGGGGG + Intergenic
1002476707 5:179470426-179470448 CTTCCCCAAGGAGCAGCTGGCGG - Intergenic
1002522754 5:179800582-179800604 GATCTCCGTGGGGAACCTGGGGG + Exonic
1002563821 5:180099271-180099293 CTGCCCTGTGGAGCCCCTGGGGG + Intergenic
1003606656 6:7567864-7567886 CATGCCCCTGCAGCACCTGCTGG + Exonic
1006943902 6:37771441-37771463 CATCTCTTTGGAGCTCCTGGAGG - Intergenic
1013391498 6:109690508-109690530 CAGCCCCGCGGAGTCCCTGGAGG - Intronic
1015799311 6:137044604-137044626 CATCCCCGACCCGCACCTGGCGG + Intronic
1016990181 6:149923048-149923070 CCAGCCCGTGGATCACCTGGCGG + Exonic
1017861879 6:158406021-158406043 CCTGCCCAAGGAGCACCTGGTGG - Intronic
1020276420 7:6627382-6627404 CCTCCCCACGGGGCACCTGGTGG + Intergenic
1021769031 7:23980166-23980188 CATCCCAGTGTTGCACCTGCTGG - Intergenic
1022701119 7:32761661-32761683 CCTCCGCGTGGAGCACCTTGGGG + Intergenic
1026050406 7:66941877-66941899 CAACCCCCTGGAGAACCTGAAGG + Exonic
1030099674 7:105934347-105934369 AATCCAGGTGGATCACCTGGAGG + Intronic
1032427683 7:131834597-131834619 AGGCCCCGTGGAGAACCTGGGGG + Intergenic
1032525695 7:132577077-132577099 CCTCCCCGGGGAGCAGCCGGCGG - Exonic
1034437933 7:151071953-151071975 CAACCACCTGGAGTACCTGGTGG + Exonic
1035362349 7:158321980-158322002 CGTCATCGAGGAGCACCTGGGGG - Intronic
1035582079 8:746833-746855 CATCCCGGTGTAGCCCCTGCTGG + Intergenic
1037298110 8:17422644-17422666 CATCCCAGTGACGCACCTCGTGG - Intergenic
1038317946 8:26503382-26503404 CCTCCCTGTGCAGCCCCTGGAGG - Intronic
1049386134 8:142344026-142344048 CACGCCCGTGGAGCAGGTGGTGG - Exonic
1049409138 8:142464702-142464724 CTTCTCCGTGGAGTACCTGGTGG + Exonic
1049645458 8:143733848-143733870 CCTGCCCGGGCAGCACCTGGGGG + Intergenic
1049749799 8:144277716-144277738 CATCCCCGTGGGACAGCTGTGGG + Intronic
1050538988 9:6653869-6653891 GATCCCCGTGGATCACCTGACGG - Intergenic
1054356463 9:64067432-64067454 CCTGCCTGTGGAGCACCTCGGGG + Intergenic
1057723108 9:97548570-97548592 CCTCCCAGGGGAGGACCTGGAGG + Intronic
1060999544 9:127895433-127895455 CAACCACCTGCAGCACCTGGAGG + Intronic
1061194949 9:129102537-129102559 CCTGCCCGTGGAGTACCTGGGGG - Exonic
1062517598 9:136944192-136944214 CAGCCCCGTGGAACTCCCGGCGG - Intronic
1203748000 Un_GL000218v1:54149-54171 CCTGCCTGTGGAGCACCTCGGGG + Intergenic
1203561724 Un_KI270744v1:63824-63846 CCTGCCTGTGGAGCACCTCGGGG - Intergenic
1187308453 X:18118565-18118587 TATCCCCTTGGTGCACCTGCTGG + Intergenic
1189097339 X:38154532-38154554 CATCACCGTGGTGGAGCTGGTGG - Exonic
1198278907 X:135123325-135123347 CATCTGCGTGGAGCATCAGGAGG + Intergenic