ID: 1076140615

View in Genome Browser
Species Human (GRCh38)
Location 10:128076178-128076200
Sequence AAATACACCCAGATGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076140615_1076140622 16 Left 1076140615 10:128076178-128076200 CCTTACTCCATCTGGGTGTATTT 0: 1
1: 0
2: 1
3: 7
4: 181
Right 1076140622 10:128076217-128076239 CCATGACACGTGGAAGTGCAGGG No data
1076140615_1076140618 -7 Left 1076140615 10:128076178-128076200 CCTTACTCCATCTGGGTGTATTT 0: 1
1: 0
2: 1
3: 7
4: 181
Right 1076140618 10:128076194-128076216 TGTATTTTTATTAAGGTTCAAGG No data
1076140615_1076140620 15 Left 1076140615 10:128076178-128076200 CCTTACTCCATCTGGGTGTATTT 0: 1
1: 0
2: 1
3: 7
4: 181
Right 1076140620 10:128076216-128076238 GCCATGACACGTGGAAGTGCAGG No data
1076140615_1076140619 6 Left 1076140615 10:128076178-128076200 CCTTACTCCATCTGGGTGTATTT 0: 1
1: 0
2: 1
3: 7
4: 181
Right 1076140619 10:128076207-128076229 AGGTTCAAGGCCATGACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076140615 Original CRISPR AAATACACCCAGATGGAGTA AGG (reversed) Intronic
902899530 1:19504915-19504937 AAATAAACACAGCTGGCGTAGGG - Intergenic
905729836 1:40289702-40289724 AAATACAACCTCTTGGAGTAAGG - Intronic
905941065 1:41863898-41863920 AAATACATCCAGATTAAGAAGGG + Intronic
906709217 1:47916654-47916676 AAATCCACACAGGTGGAGAAGGG + Intronic
911300829 1:96171565-96171587 AAATCCACTCAAATGGAGAAGGG - Intergenic
911614480 1:99993452-99993474 AAAAACACCGAGAGGGAGAAGGG - Intronic
912014415 1:105015050-105015072 AAAAAAACCTAGATGGAGCAGGG - Intergenic
916759475 1:167803572-167803594 AATCACAGCCAGATGGAGGAGGG + Intergenic
917658479 1:177152912-177152934 AAATAGACCCAAATGTATTATGG + Intronic
919141031 1:193571885-193571907 AAATTAACCAAGATGGATTAAGG - Intergenic
920547172 1:206827854-206827876 AAAGACACCCAGGTGGGGTGTGG - Intronic
1064858895 10:19803268-19803290 AAATCCAACCAGAAAGAGTATGG + Intergenic
1065142094 10:22727887-22727909 CACTGCACCCAGATGGAGGAAGG + Intergenic
1066479783 10:35784564-35784586 AAATACACCCAGAAGAACAAAGG - Intergenic
1071288522 10:84171564-84171586 GTTTCCACCCAGATGGAGTAGGG + Intergenic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1076140615 10:128076178-128076200 AAATACACCCAGATGGAGTAAGG - Intronic
1076455967 10:130595812-130595834 ACATACATCCAGATGGATTCTGG + Intergenic
1077321959 11:1946741-1946763 AAAAACAGCCAGATGGAGAGAGG + Intergenic
1078121069 11:8509394-8509416 AAATACACCCAAATAAAATACGG + Intronic
1080609591 11:33892380-33892402 AAATACAGGCTGATGGTGTAGGG - Intergenic
1080798404 11:35587254-35587276 CAAGAGACCCAGATTGAGTATGG + Intergenic
1081193502 11:40133242-40133264 CAATATACCCAGAAGGTGTATGG + Intronic
1082958462 11:58896622-58896644 AAGGACACAAAGATGGAGTAGGG + Intronic
1083326043 11:61873520-61873542 AAATACATTCAGATGTATTATGG - Exonic
1085760770 11:79239320-79239342 AAATACAACCAGAAGGAAAAGGG + Intronic
1086280768 11:85185150-85185172 AGATACACCAAGATGCAGTTTGG + Intronic
1086828924 11:91534943-91534965 AAATACACCCACATTCAGTGGGG - Intergenic
1087542553 11:99538978-99539000 ATGTAAACCCAGGTGGAGTAGGG + Intronic
1088180023 11:107098709-107098731 AAATCAACCCAGATGGATTAAGG + Intergenic
1088231188 11:107675224-107675246 AAATACATCAAGATGGAACAAGG + Intergenic
1202804975 11_KI270721v1_random:2054-2076 AAAAACAGCCAGATGGAGAGAGG + Intergenic
1092200391 12:6578647-6578669 AGAGACACCCAGGTGGAGAAGGG - Intronic
1092206525 12:6617814-6617836 ATCTCCACCCAGATGGAGAAAGG + Intergenic
1093028257 12:14264391-14264413 AAAAACATCCAGAGGGAGAAAGG - Intergenic
1096938787 12:55317255-55317277 AAATAAACCCTGATGAAATAAGG + Intergenic
1096961918 12:55588070-55588092 AAATCAACCAAGATGGATTAAGG + Intergenic
1099824821 12:87761656-87761678 TAATTCACCCAGAGGGAGTAAGG - Intergenic
1100140651 12:91614747-91614769 ATATACACCCCTAGGGAGTATGG - Intergenic
1103913667 12:124365092-124365114 AAATACACCCAAATGCAGGCCGG - Intronic
1104334705 12:127883143-127883165 AAACACACCCACAAGGAATATGG - Intergenic
1105318706 13:19294864-19294886 AAATACAAGCAGATATAGTATGG + Intergenic
1107734931 13:43389064-43389086 AATTACACCCAGATTTAGCAGGG + Intronic
1108839324 13:54593086-54593108 AGATTCCACCAGATGGAGTAGGG - Intergenic
1109583007 13:64365851-64365873 TAACACACCCAGATGAAGAAAGG - Intergenic
1111605848 13:90538220-90538242 AAAAATACCCAGATGGTGTGGGG + Intergenic
1111900232 13:94190723-94190745 AAATACACCCTGAAGTATTAAGG + Intronic
1116778069 14:49204108-49204130 AAATAAACCCAGAGAGAGTTTGG + Intergenic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1119547008 14:75479320-75479342 AGGTACACCCAGCTGGAGTGGGG - Intergenic
1124496050 15:30187833-30187855 AAATAAACCCAGATGGGCTTGGG - Intergenic
1124747524 15:32350814-32350836 AAATAAACCCAGATGGGCTTGGG + Intergenic
1124921649 15:34032765-34032787 GAATACAGCCAGATTGAGAATGG - Intronic
1125101545 15:35918779-35918801 AAATACAGTTAGAAGGAGTAAGG + Intergenic
1128902770 15:71440106-71440128 ACATTCACCCAAATGGACTAAGG + Intronic
1131961519 15:97794220-97794242 AAATACAGCCAGATGCCTTATGG - Intergenic
1135586714 16:23677327-23677349 AACCACACCCAGATTGAGAAAGG - Exonic
1137284863 16:47007101-47007123 AAATAGACACAGATGCAATAGGG + Intergenic
1138838178 16:60463814-60463836 AAATACATACAGATGCAATAAGG - Intergenic
1142524289 17:528063-528085 AATTAATCCCAGATGGATTATGG - Intronic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1148990800 17:51665614-51665636 ATATAAACCCAGATGGTATATGG + Intronic
1151410205 17:73920170-73920192 AAAGACACGCAGAGGGAGTCTGG + Intergenic
1153177697 18:2397269-2397291 AAATACCCCCAAATGGAAAAAGG - Intergenic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1158171245 18:54603135-54603157 ATATGGACCCAGATGGAGAAAGG + Intergenic
1159184582 18:64952256-64952278 ACATTAAACCAGATGGAGTAGGG + Intergenic
1159741413 18:72175854-72175876 AATTACATGCAGATGTAGTATGG - Intergenic
1164746565 19:30620469-30620491 ACATTCACCCAGATGGGGAATGG + Intronic
1165073623 19:33269186-33269208 AAATACACACACACGGGGTAGGG + Intergenic
1165549532 19:36572487-36572509 AAACACACCCAGATCGAAGAGGG + Intronic
925168205 2:1732380-1732402 AGAGCCACCCAAATGGAGTAGGG + Intronic
930311840 2:49751961-49751983 AAATACTTCCAGAAGAAGTATGG + Intergenic
931716964 2:65037023-65037045 AAATGGACAAAGATGGAGTATGG - Intergenic
934139102 2:89027967-89027989 AAATTCACCCAGATGATGTTTGG + Intergenic
934230140 2:90172593-90172615 AAATTCACCCAGATGATGTTTGG - Intergenic
934609902 2:95727366-95727388 AAAATCACCCAAATGTAGTAAGG - Intergenic
935554720 2:104496762-104496784 AAATAGACACAGATAGAGAAGGG - Intergenic
936876332 2:117194193-117194215 AAGTACACCCAATTGGAGTTTGG + Intergenic
936988116 2:118331238-118331260 CAATACCCCCAGATGGGGAAGGG + Intergenic
937532465 2:122845712-122845734 AAATACATACATATGCAGTATGG + Intergenic
940470937 2:154099564-154099586 AAATTAACCAAGATGGATTAAGG - Intronic
941586876 2:167370583-167370605 AAAGACATTGAGATGGAGTAGGG + Intergenic
942162224 2:173202740-173202762 AAATGCACCCGGATGGAGTTGGG + Intronic
942350416 2:175046719-175046741 AAATACACCAATAATGAGTAAGG - Intergenic
943195726 2:184746277-184746299 AAATACACTTAGAAGGAATAAGG - Intronic
943668718 2:190637926-190637948 AAATATACCCAGAGGTATTAAGG - Intergenic
947846995 2:233252355-233252377 AAAACCACCAAGGTGGAGTAAGG - Intronic
1169707665 20:8524240-8524262 AAATACACCCATATGGCTTTAGG + Intronic
1172553410 20:35819637-35819659 ACACACACACAGATGGTGTAAGG - Intronic
1174551617 20:51366534-51366556 AAATCGACTCAGATGGAGAAAGG + Intergenic
1178085595 21:29108614-29108636 AAACATACCCAGATGCTGTAAGG - Intronic
1178204440 21:30447108-30447130 TACTACACCTGGATGGAGTATGG + Intergenic
1179062178 21:37989276-37989298 AAATACAACCAAATAGAGTGTGG + Intronic
1179343605 21:40535781-40535803 AGATACACCTAAATGGAGCAAGG + Intronic
1180935046 22:19619899-19619921 AAATACAGCCATATGGGGTTGGG - Intergenic
1183636475 22:39066420-39066442 AAATACATCCAGATGGCCTGAGG - Intronic
950802107 3:15561167-15561189 AAGTACACTCAGAAGGAGAAGGG + Intronic
951722852 3:25720184-25720206 AAATATACCTATAAGGAGTAGGG + Exonic
951942159 3:28091419-28091441 AAAAAAACCCGGATGGAATATGG - Intergenic
952513206 3:34077601-34077623 GAATAAACCCATAGGGAGTAAGG - Intergenic
952890021 3:38033671-38033693 AAATACACCCTGAAGCAGGAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
956592275 3:70927301-70927323 AAATCCTCCCAGATAGAGCAGGG - Intergenic
960457938 3:117896711-117896733 AAATGCACCCATATAGAATAGGG + Intergenic
961210372 3:125120690-125120712 AAAGACACCCAGATGGGGAATGG + Intronic
965031044 3:163368872-163368894 AAATAGACACAGATTGAGTTAGG + Intergenic
966070372 3:175870316-175870338 ACATACACCTATATGTAGTATGG + Intergenic
966658029 3:182382109-182382131 AAAAACACCCAGACAGAATAAGG + Intergenic
968420013 4:475932-475954 AAATACACCCACATGGATTCTGG - Intronic
971095118 4:23391875-23391897 AAATACACACACATAGAGAAAGG - Intergenic
971102753 4:23485979-23486001 AAAGACACCAGGATGGAGAATGG + Intergenic
971138901 4:23901681-23901703 AAATACACACAGAGGGAAGAAGG + Intronic
973203067 4:47527186-47527208 AAAGACACATAGATGGAGAAAGG + Intronic
974700342 4:65435542-65435564 AAATACTCCCAGATAAATTAAGG + Intronic
974804953 4:66866865-66866887 AGTTACACACAGATAGAGTACGG - Intergenic
975031823 4:69630126-69630148 AAATACAGCCATATGGATCAGGG + Intronic
977825931 4:101531600-101531622 AAATCAACTCAGATGGATTAAGG - Intronic
979179147 4:117703794-117703816 AAATATACCCAGATGCAGGCTGG + Intergenic
980164259 4:129205911-129205933 AAGTACACACAGACAGAGTATGG - Intergenic
982312383 4:153999670-153999692 AAATACAAACAGGTGGAGGAAGG - Intergenic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
983606152 4:169587198-169587220 CAAAACACCCAGATTGAGTTTGG - Intronic
983863126 4:172733454-172733476 AAATACCCCCATAGGGATTATGG - Intronic
986199172 5:5565813-5565835 AAACAAAAGCAGATGGAGTACGG - Intergenic
988670517 5:33376290-33376312 AATTAGACCCTGATGGGGTATGG - Intergenic
989214666 5:38892053-38892075 AAAAACTCCCAGAGGTAGTAAGG + Intronic
990493801 5:56326880-56326902 AAACACACCTAGAGGGAGTGTGG + Intergenic
990869148 5:60412396-60412418 AAATACCTCCAGATGGAGTAAGG - Intronic
992159296 5:73984978-73985000 AAATAGACCCAGATGGCTCAAGG - Intergenic
992359764 5:76025063-76025085 GAACACACACAGATGGAGTGTGG - Intergenic
994205511 5:97031344-97031366 AAATAAAACAAGATGGAGGAAGG - Exonic
994733071 5:103517202-103517224 GAAGACACCCAGATGGGATATGG + Intergenic
995639730 5:114241473-114241495 AAATATACCAAAATGGAGTCAGG + Intergenic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003533874 6:6959170-6959192 AAAGACACTGAGATGGAGTTTGG + Intergenic
1003803510 6:9699359-9699381 ACACACACACAGATGTAGTATGG - Intronic
1004354301 6:14917885-14917907 AAATGTTCCCAAATGGAGTATGG - Intergenic
1008812489 6:55520723-55520745 AAATAAAACCAGATGTAGAAAGG - Intronic
1010447304 6:75962528-75962550 GAATAAACCCAGAGGGAGAAGGG + Intronic
1013124634 6:107170931-107170953 AAAGACAACCAGTTGAAGTATGG - Intronic
1015273466 6:131360402-131360424 AAATACAGTCACATGGATTAGGG + Intergenic
1015821551 6:137266648-137266670 AAATACACACAAATGGAGAGAGG + Intergenic
1015875558 6:137818495-137818517 AAATACACCAAGAGGGAGAGAGG - Intergenic
1017657286 6:156642128-156642150 AAACCAACCCAGATGTAGTATGG + Intergenic
1018827355 6:167419718-167419740 AAATACACCATGATTGAATACGG - Intergenic
1018973803 6:168548251-168548273 ATTTACACCCAGATGGACTTGGG - Intronic
1019013535 6:168862553-168862575 AAACCCACACAGATGGAGTGCGG - Intergenic
1020774373 7:12434862-12434884 TAGTAAACCCAGATGGAATATGG - Intergenic
1024196332 7:47062442-47062464 AGAGACACCCAAATGGACTAAGG + Intergenic
1024272322 7:47651711-47651733 AAATAAACCCACATGAATTATGG + Intergenic
1028178765 7:87690865-87690887 AAATGTACCAAGATGGAATATGG - Intronic
1028345464 7:89776120-89776142 AAATACACAAGGATGGGGTAAGG - Intergenic
1033897650 7:146094450-146094472 AAATGCAAGCAGATGGAGCAGGG + Intergenic
1036023596 8:4877680-4877702 AAATAATTCCAGATGGAATAGGG - Intronic
1036034031 8:4999775-4999797 GAAGAAACCCAGATGGAGAATGG + Intergenic
1036212884 8:6856736-6856758 AAATAAGCCCAGATGGATTTAGG + Intergenic
1036762552 8:11519456-11519478 ACATACATCCACATGTAGTAGGG + Intronic
1037217389 8:16473565-16473587 AAATACACCTAGGTAGATTAGGG - Intronic
1037675698 8:21049171-21049193 AAAGACTCCCAGATAGAGAAAGG - Intergenic
1041661567 8:60406306-60406328 AAATCAGCCCAGATGAAGTAAGG - Intergenic
1042420584 8:68583893-68583915 AAATCCACTCACAAGGAGTACGG - Intronic
1042488227 8:69369804-69369826 AAAAACACCCAGAGTGAGCAAGG - Intergenic
1043944099 8:86230497-86230519 AAATAGACCAAGATGTAGAAGGG + Intronic
1047553626 8:125904510-125904532 AAATGCATCCAGATGGAAAATGG + Intergenic
1048729032 8:137417686-137417708 ACATACACACATATGCAGTATGG + Intergenic
1049256601 8:141617422-141617444 AAACACAACCAGATGGTGCAAGG + Intergenic
1051026103 9:12613552-12613574 AAATAAACCATGATGGATTAGGG - Intergenic
1051876961 9:21803162-21803184 AAAGACACCCGGCTGGAGTCAGG + Intronic
1052237001 9:26222996-26223018 AAATAAAGCCAGATAGAGGATGG - Intergenic
1053133621 9:35635071-35635093 AAAGACCCCCAGATGGAATGTGG - Intronic
1053163978 9:35831800-35831822 CAATACACCCAAATGGAGGCAGG + Intronic
1053430169 9:38037013-38037035 AAATAGACCCAGAGAGAGCAAGG + Intronic
1055261841 9:74446238-74446260 AAATACACACAGATGTATTTAGG + Intergenic
1055553604 9:77453760-77453782 AAATACAGCAACATGGAGTGGGG + Intronic
1055709588 9:79045458-79045480 AAGTACTCCCAGGTGGAGGAGGG - Intergenic
1057055594 9:91958220-91958242 AAAGAAACCCAGTTGGATTAGGG - Intergenic
1057727348 9:97577290-97577312 AACTACACGCAGATGGTGTTTGG - Intronic
1058403952 9:104650369-104650391 ATATACACAGAGATGGAGAATGG + Intergenic
1187224112 X:17359516-17359538 AGATACATCTAGATGGAGGAGGG + Intergenic
1188417181 X:29950164-29950186 AAATACATCCAGATGACATAAGG + Intronic
1190146927 X:47901648-47901670 TAATACACCATGATGAAGTAAGG - Intronic
1192640211 X:72855107-72855129 AAAGACACCCATGTGGAGTAAGG - Intergenic
1192641500 X:72865669-72865691 AAAGACACCCATGTGGAGTAAGG + Intergenic
1194088398 X:89556792-89556814 AAATTCACCCAGATGAATTTTGG + Intergenic
1197493902 X:127153831-127153853 AAATGCCACCAGATGGAGGAAGG + Intergenic
1197559379 X:127999214-127999236 AAATACACCCAGGTGTTGTTAGG + Intergenic
1197799493 X:130334786-130334808 AAATACACAAAAATGTAGTATGG + Intergenic
1197993585 X:132346943-132346965 AAATAAAACCAAATGGATTAAGG + Intergenic
1200441074 Y:3212831-3212853 AAATTCACCCAGATGAATTTTGG + Intergenic