ID: 1076142413

View in Genome Browser
Species Human (GRCh38)
Location 10:128090389-128090411
Sequence ATCCATTGCAAGCCTGGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076142407_1076142413 17 Left 1076142407 10:128090349-128090371 CCACCAGAAACCTGGGCACTCAA No data
Right 1076142413 10:128090389-128090411 ATCCATTGCAAGCCTGGTTAGGG No data
1076142408_1076142413 14 Left 1076142408 10:128090352-128090374 CCAGAAACCTGGGCACTCAAAAT No data
Right 1076142413 10:128090389-128090411 ATCCATTGCAAGCCTGGTTAGGG No data
1076142409_1076142413 7 Left 1076142409 10:128090359-128090381 CCTGGGCACTCAAAATGTAACAG No data
Right 1076142413 10:128090389-128090411 ATCCATTGCAAGCCTGGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076142413 Original CRISPR ATCCATTGCAAGCCTGGTTA GGG Intergenic
No off target data available for this crispr