ID: 1076142515

View in Genome Browser
Species Human (GRCh38)
Location 10:128091096-128091118
Sequence GGAATGTGGCGTCACAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076142508_1076142515 11 Left 1076142508 10:128091062-128091084 CCTCTCTTGCCAGATGCTGTTCC No data
Right 1076142515 10:128091096-128091118 GGAATGTGGCGTCACAGTGCAGG No data
1076142512_1076142515 -10 Left 1076142512 10:128091083-128091105 CCTCTGCCCTAATGGAATGTGGC No data
Right 1076142515 10:128091096-128091118 GGAATGTGGCGTCACAGTGCAGG No data
1076142509_1076142515 2 Left 1076142509 10:128091071-128091093 CCAGATGCTGTTCCTCTGCCCTA No data
Right 1076142515 10:128091096-128091118 GGAATGTGGCGTCACAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076142515 Original CRISPR GGAATGTGGCGTCACAGTGC AGG Intergenic
No off target data available for this crispr