ID: 1076143710

View in Genome Browser
Species Human (GRCh38)
Location 10:128099710-128099732
Sequence TGGTTCCTCTCCCTTAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076143710_1076143712 -8 Left 1076143710 10:128099710-128099732 CCTTGGCTAAGGGAGAGGAACCA No data
Right 1076143712 10:128099725-128099747 AGGAACCATGGTGAAAAGCATGG No data
1076143710_1076143714 10 Left 1076143710 10:128099710-128099732 CCTTGGCTAAGGGAGAGGAACCA No data
Right 1076143714 10:128099743-128099765 CATGGCTACAAGCTTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076143710 Original CRISPR TGGTTCCTCTCCCTTAGCCA AGG (reversed) Intronic