ID: 1076143712

View in Genome Browser
Species Human (GRCh38)
Location 10:128099725-128099747
Sequence AGGAACCATGGTGAAAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076143702_1076143712 24 Left 1076143702 10:128099678-128099700 CCTTGGCCTTTACTCTTGCAGTA No data
Right 1076143712 10:128099725-128099747 AGGAACCATGGTGAAAAGCATGG No data
1076143710_1076143712 -8 Left 1076143710 10:128099710-128099732 CCTTGGCTAAGGGAGAGGAACCA No data
Right 1076143712 10:128099725-128099747 AGGAACCATGGTGAAAAGCATGG No data
1076143701_1076143712 28 Left 1076143701 10:128099674-128099696 CCTGCCTTGGCCTTTACTCTTGC No data
Right 1076143712 10:128099725-128099747 AGGAACCATGGTGAAAAGCATGG No data
1076143708_1076143712 -6 Left 1076143708 10:128099708-128099730 CCCCTTGGCTAAGGGAGAGGAAC No data
Right 1076143712 10:128099725-128099747 AGGAACCATGGTGAAAAGCATGG No data
1076143709_1076143712 -7 Left 1076143709 10:128099709-128099731 CCCTTGGCTAAGGGAGAGGAACC No data
Right 1076143712 10:128099725-128099747 AGGAACCATGGTGAAAAGCATGG No data
1076143703_1076143712 18 Left 1076143703 10:128099684-128099706 CCTTTACTCTTGCAGTAGTTCTC No data
Right 1076143712 10:128099725-128099747 AGGAACCATGGTGAAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076143712 Original CRISPR AGGAACCATGGTGAAAAGCA TGG Intronic