ID: 1076143714

View in Genome Browser
Species Human (GRCh38)
Location 10:128099743-128099765
Sequence CATGGCTACAAGCTTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076143708_1076143714 12 Left 1076143708 10:128099708-128099730 CCCCTTGGCTAAGGGAGAGGAAC No data
Right 1076143714 10:128099743-128099765 CATGGCTACAAGCTTCTTACTGG No data
1076143710_1076143714 10 Left 1076143710 10:128099710-128099732 CCTTGGCTAAGGGAGAGGAACCA No data
Right 1076143714 10:128099743-128099765 CATGGCTACAAGCTTCTTACTGG No data
1076143709_1076143714 11 Left 1076143709 10:128099709-128099731 CCCTTGGCTAAGGGAGAGGAACC No data
Right 1076143714 10:128099743-128099765 CATGGCTACAAGCTTCTTACTGG No data
1076143713_1076143714 -10 Left 1076143713 10:128099730-128099752 CCATGGTGAAAAGCATGGCTACA No data
Right 1076143714 10:128099743-128099765 CATGGCTACAAGCTTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076143714 Original CRISPR CATGGCTACAAGCTTCTTAC TGG Intronic