ID: 1076143714 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:128099743-128099765 |
| Sequence | CATGGCTACAAGCTTCTTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076143708_1076143714 | 12 | Left | 1076143708 | 10:128099708-128099730 | CCCCTTGGCTAAGGGAGAGGAAC | No data | ||
| Right | 1076143714 | 10:128099743-128099765 | CATGGCTACAAGCTTCTTACTGG | No data | ||||
| 1076143710_1076143714 | 10 | Left | 1076143710 | 10:128099710-128099732 | CCTTGGCTAAGGGAGAGGAACCA | No data | ||
| Right | 1076143714 | 10:128099743-128099765 | CATGGCTACAAGCTTCTTACTGG | No data | ||||
| 1076143709_1076143714 | 11 | Left | 1076143709 | 10:128099709-128099731 | CCCTTGGCTAAGGGAGAGGAACC | No data | ||
| Right | 1076143714 | 10:128099743-128099765 | CATGGCTACAAGCTTCTTACTGG | No data | ||||
| 1076143713_1076143714 | -10 | Left | 1076143713 | 10:128099730-128099752 | CCATGGTGAAAAGCATGGCTACA | No data | ||
| Right | 1076143714 | 10:128099743-128099765 | CATGGCTACAAGCTTCTTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076143714 | Original CRISPR | CATGGCTACAAGCTTCTTAC TGG | Intronic | ||