ID: 1076146396

View in Genome Browser
Species Human (GRCh38)
Location 10:128125963-128125985
Sequence CGCCCTCGCCAGAGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076146392_1076146396 -3 Left 1076146392 10:128125943-128125965 CCTGGGAGCTTCCACCGAGACGC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG 0: 1
1: 1
2: 1
3: 14
4: 192
1076146391_1076146396 0 Left 1076146391 10:128125940-128125962 CCTCCTGGGAGCTTCCACCGAGA 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG 0: 1
1: 1
2: 1
3: 14
4: 192
1076146389_1076146396 12 Left 1076146389 10:128125928-128125950 CCAGCGCCTGCGCCTCCTGGGAG 0: 1
1: 0
2: 0
3: 36
4: 339
Right 1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG 0: 1
1: 1
2: 1
3: 14
4: 192
1076146390_1076146396 6 Left 1076146390 10:128125934-128125956 CCTGCGCCTCCTGGGAGCTTCCA 0: 1
1: 0
2: 1
3: 28
4: 268
Right 1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG 0: 1
1: 1
2: 1
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076146396 Original CRISPR CGCCCTCGCCAGAGCCCAGG AGG Intronic
900366529 1:2314064-2314086 TGCCCTCGCCAGGGCCTGGGGGG + Intergenic
900598395 1:3492844-3492866 GGCCCGCGGCAGAGCCCAGGTGG + Intronic
900798826 1:4725422-4725444 AGCCCTCGCCAGGCACCAGGGGG - Intronic
901513441 1:9729883-9729905 CTCCCTCCCCAGACCCCAGAGGG - Exonic
902754128 1:18537896-18537918 CACCCGAGCCAGGGCCCAGGAGG + Intergenic
903597043 1:24502894-24502916 CGCCCTAGTCCCAGCCCAGGGGG + Exonic
903600533 1:24535307-24535329 CGCCATGGCCAGAGCCCACCAGG - Exonic
904673146 1:32180653-32180675 CCAACTCGCCAGAGCGCAGGGGG - Intronic
905289266 1:36910483-36910505 CGCCTTAGCCAGACCCCTGGGGG + Intronic
905441993 1:38001528-38001550 TGTCCTCACCAGAGCCCAGCTGG - Intronic
905449193 1:38046297-38046319 CGCCCTCGCCCGGGGCCAGCGGG - Exonic
906798758 1:48718289-48718311 TGCCCTCCACAGGGCCCAGGAGG - Intronic
908401388 1:63774956-63774978 GGTGCTCGCCAGAGCCCAGGCGG + Intronic
916890032 1:169105887-169105909 CCACCCCGCCAGCGCCCAGGAGG + Intronic
919915993 1:202139733-202139755 GACCCTCGCTTGAGCCCAGGAGG - Intronic
920380756 1:205533285-205533307 CTCCCTCCCCAGAAGCCAGGGGG - Intergenic
1062818852 10:519221-519243 CGGCCACACCAGGGCCCAGGAGG + Intronic
1062848441 10:725715-725737 AGCCCTGCCCAGAGCCCAGCAGG + Intergenic
1064134225 10:12736745-12736767 CGCTCTCGCCAGAGCCAGCGTGG + Intronic
1064310515 10:14208345-14208367 AGCCCTCCCCAGAGACCTGGGGG - Intronic
1067227880 10:44387024-44387046 CGCCCTCGACTCAGCCCACGCGG - Intergenic
1067877866 10:50020533-50020555 AGCCCTCGCCCCAGCCCAGTAGG - Intergenic
1069922900 10:71828019-71828041 CGGCCATGCCAGGGCCCAGGCGG + Exonic
1070132211 10:73663869-73663891 AGCCCTCGCCCCAGCCCAGTAGG + Intergenic
1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG + Intronic
1077225823 11:1438732-1438754 CGTCCTGGGCAGAGGCCAGGAGG - Intronic
1077329337 11:1977083-1977105 GGCCCACCCCAGGGCCCAGGAGG - Intronic
1079054385 11:17193119-17193141 CGCCCTCACCAGATGCCAAGCGG + Intronic
1080807069 11:35663108-35663130 CGCCCACTCCAGAGGCCATGTGG - Exonic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083266811 11:61550661-61550683 CTCCATTTCCAGAGCCCAGGTGG + Intronic
1084117082 11:67048823-67048845 TGCCCTCTCCATAGCCCAGCTGG + Exonic
1089496459 11:118910629-118910651 CCCCTTCGGCAGAGCCCGGGCGG + Exonic
1091223737 11:133945824-133945846 AGCCCTCTCCACAGCCCAGGCGG + Intronic
1202812316 11_KI270721v1_random:32262-32284 GGCCCACCCCAGGGCCCAGGAGG - Intergenic
1097794096 12:63844128-63844150 CGCCCTGGGCACAGCCCCGGCGG - Intergenic
1097968086 12:65602925-65602947 GGCCCTCGCCCTAGTCCAGGAGG - Intergenic
1103730307 12:123022924-123022946 CTCCCTCCCCAGAGCCCCGCTGG + Intronic
1103855966 12:123972130-123972152 CGCCCACCCCAGTGCCAAGGGGG - Intronic
1105024888 12:132841361-132841383 GACCCTCCCCAGAGCCCCGGGGG - Exonic
1105071447 12:133236244-133236266 CGCCGGCGCCAGAGCCAGGGCGG - Intergenic
1106243362 13:27927242-27927264 GCCCCACCCCAGAGCCCAGGCGG - Intergenic
1112216319 13:97434314-97434336 CGCCGCCGCCGGCGCCCAGGGGG + Exonic
1113660823 13:112105431-112105453 CGGCCCCGCCAGCGCCCGGGAGG - Intergenic
1113722997 13:112574920-112574942 CTCCCCAGCCAGGGCCCAGGTGG + Intronic
1113892045 13:113741341-113741363 GGCCCTCCCCAGAGGCCAGCTGG - Intergenic
1115850052 14:37583958-37583980 CGCGCCCCCCCGAGCCCAGGGGG + Intergenic
1117253426 14:53956057-53956079 CGCACTCTCCAGAGGCCAGCAGG + Intronic
1119176107 14:72568640-72568662 CGCCCTCCCCAGACCCCACATGG + Intergenic
1120832358 14:89008659-89008681 TGCACTAGCCAGAGCCAAGGGGG + Intergenic
1121090291 14:91176687-91176709 CTCCCTCGCTGGAGCCCAGGAGG - Intronic
1121725066 14:96141320-96141342 GTCCCTAGCCAGAGCCCAGATGG + Intergenic
1121729366 14:96175705-96175727 AGCCCTTTCCAGACCCCAGGAGG + Intergenic
1122066231 14:99175911-99175933 GGCCCTCGCCGAAGCCCGGGTGG + Exonic
1122836302 14:104432602-104432624 GACCCTGGCCAGAGCCCTGGTGG - Intergenic
1123041744 14:105493065-105493087 CTCCCCCTCCAGTGCCCAGGAGG - Intronic
1123115859 14:105893742-105893764 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123117884 14:105902852-105902874 GGCCTGCCCCAGAGCCCAGGAGG - Intergenic
1123120101 14:105912457-105912479 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123402839 15:20004043-20004065 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1123512176 15:21010697-21010719 GGCCCGTCCCAGAGCCCAGGAGG - Intergenic
1126065904 15:44826220-44826242 GGACCTCACCAGAGACCAGGAGG - Intergenic
1126093930 15:45074346-45074368 GGACCTCACCAGAGACCAGGAGG + Exonic
1129154880 15:73711536-73711558 CGCCCCCTCCAGAGCCAAGAGGG + Intronic
1131055398 15:89371733-89371755 CGGCCTCGCCTGGGCCCTGGAGG - Intergenic
1131108804 15:89751422-89751444 CGCCCAAGCGAGGGCCCAGGTGG - Intergenic
1132602973 16:782124-782146 CTCCCTCTCCACACCCCAGGGGG - Intronic
1132629488 16:910312-910334 CCCCCACACCAGGGCCCAGGAGG + Intronic
1132659514 16:1055147-1055169 AGCCCTCGCCACAGGGCAGGAGG + Intergenic
1132670848 16:1101801-1101823 CGCCCTCGACACAGCCCCAGGGG - Intergenic
1132694466 16:1195720-1195742 CTCCCTCACCTGTGCCCAGGAGG - Intronic
1132810475 16:1794454-1794476 GGCCCTCACCAGAGCCTTGGGGG - Intronic
1133301211 16:4783922-4783944 CCCCCTCACCAGTGCCCAGTGGG + Exonic
1134442432 16:14307258-14307280 TGCCCTCGCCAGAGCCCACAGGG - Intergenic
1134884909 16:17781909-17781931 AGCTCTCCCCAGAGCTCAGGTGG + Intergenic
1135207485 16:20495117-20495139 GGCCCACTCCAGAGTCCAGGAGG - Intergenic
1135211400 16:20528515-20528537 GGCCCACTCCAGAGTCCAGGAGG + Intergenic
1136284909 16:29234993-29235015 CGCCTTGGCCAGAACGCAGGAGG + Intergenic
1137793045 16:51191044-51191066 TGCCCTCACAAGAGCCTAGGAGG + Intergenic
1138096285 16:54214437-54214459 CGCCCATCCCAGAGCCCACGGGG - Intergenic
1138234546 16:55370946-55370968 CTCCCTCGGTAGAGCCCTGGAGG - Intergenic
1138555644 16:57769838-57769860 GGCCTTTGCCAGAGCCCAGGTGG - Exonic
1139871904 16:70114577-70114599 CGACTTCGCGAGAGGCCAGGCGG - Intronic
1140364023 16:74367906-74367928 CGACTTCGCGAGAGGCCAGGCGG + Intergenic
1141667401 16:85472982-85473004 CTCCCTCGCCTGTGCCCATGTGG - Intergenic
1141957919 16:87384531-87384553 CGGCCTCGGCGGAGCCCAGCTGG - Intronic
1142177388 16:88651396-88651418 CGGCCTCTCCAGAGCCTTGGGGG + Intergenic
1144132423 17:12259778-12259800 CTGCCTTCCCAGAGCCCAGGAGG - Intergenic
1144161992 17:12568868-12568890 CCTCCTCTCCAGAGCCTAGGGGG - Intergenic
1144504325 17:15817334-15817356 TGCCAGGGCCAGAGCCCAGGAGG + Intergenic
1144634078 17:16893002-16893024 TGCCAGGGCCAGAGCCCAGGAGG + Intergenic
1145168182 17:20632843-20632865 TGCCAGGGCCAGAGCCCAGGAGG + Intergenic
1146164267 17:30575812-30575834 TGCCAGGGCCAGAGCCCAGGAGG + Intergenic
1146403668 17:32519457-32519479 CGCCGCCGCCAGAGCCCACCCGG - Intronic
1146703302 17:34980778-34980800 GGCCCTCCCGGGAGCCCAGGGGG + Intronic
1147218446 17:38914354-38914376 CGCCCCCGCTAGGGCCCATGCGG - Exonic
1147590001 17:41676586-41676608 TTCCCTCCCCAGAGGCCAGGAGG - Intergenic
1147923215 17:43931386-43931408 CGGCCTGGCCAGGCCCCAGGTGG - Intergenic
1147971333 17:44220172-44220194 CGACCTCGCCAGACCCGCGGGGG + Intronic
1148197963 17:45728505-45728527 TGCCTGCACCAGAGCCCAGGAGG + Intergenic
1148855086 17:50574588-50574610 CCCCCTCTCCCAAGCCCAGGAGG - Intronic
1150226547 17:63527654-63527676 TGCCCTCACCAGGGCCCTGGAGG - Intronic
1151188877 17:72383180-72383202 CGCCCTCCCCAGAGGTCAGGAGG - Intergenic
1152103166 17:78314443-78314465 CGCCCTGCCCAGGGCGCAGGTGG + Intergenic
1152425242 17:80214967-80214989 AGGCCAGGCCAGAGCCCAGGAGG - Intronic
1157520528 18:48342279-48342301 CCCCCTGCCCAGAGCCCAAGTGG + Intronic
1161076575 19:2288659-2288681 CGTCCTCCCCACAGCCCAGCAGG - Intronic
1161400751 19:4065572-4065594 CGCCCTCCCCCCAGCCCGGGTGG - Intronic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1161597352 19:5157406-5157428 CCCCCTCCCAAGAGTCCAGGGGG + Intergenic
1162019383 19:7861771-7861793 CGCCCAAGGCAGAGCTCAGGAGG + Intronic
1162895983 19:13764879-13764901 CGCCCCGGCCATAGCCCTGGTGG + Exonic
1163713108 19:18858654-18858676 CAGCGTCCCCAGAGCCCAGGAGG + Intronic
1163716085 19:18873103-18873125 AACCCTTGCAAGAGCCCAGGGGG - Intronic
1163758333 19:19120094-19120116 CGTCCTCCCCAGAGCCGATGGGG + Exonic
1166354248 19:42217561-42217583 CCCGCTCCCCAGAGCCCAGGTGG + Intronic
1166437890 19:42785170-42785192 TGCCCTGGCCCCAGCCCAGGTGG + Intronic
1167797797 19:51721182-51721204 AGCCCTCGGGAGAGCCCTGGGGG + Intronic
1168401571 19:56088445-56088467 TGCCCTCGCCATCGCCCACGGGG + Exonic
924996466 2:366093-366115 CGTCCTCGCCAGGACTCAGGCGG + Intergenic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
925355347 2:3237113-3237135 CGCCCTCCCCATCTCCCAGGTGG - Intronic
926006109 2:9374550-9374572 CCCCCTGGCCAGTTCCCAGGAGG + Intronic
934660733 2:96142445-96142467 CGCCCACGCCAGAAGCCAAGGGG - Intergenic
939243978 2:139599216-139599238 CGCCCTCACCAGAACCATGGTGG - Intergenic
940316805 2:152335468-152335490 CGCCCTCCGCCGCGCCCAGGCGG - Exonic
945081033 2:206086015-206086037 GGCTCTCGCCGGAGCCCAGGGGG - Exonic
947405150 2:229768170-229768192 GGATCTCGCCTGAGCCCAGGAGG + Intronic
947536674 2:230944039-230944061 CTCCCTGGCCCTAGCCCAGGAGG + Intronic
947840439 2:233204330-233204352 CGTGCTCACCAAAGCCCAGGAGG + Exonic
948874649 2:240820147-240820169 CGCCCATGCCAGTGCCCATGCGG - Exonic
1169130875 20:3165913-3165935 CGCCCTCCCCAGAGCCCAGGTGG + Exonic
1173665011 20:44757143-44757165 CGTCCTCCCCAGACCCCATGGGG - Intronic
1174046765 20:47739317-47739339 GGCCTTCCCCAGATCCCAGGAGG - Intronic
1175760676 20:61560629-61560651 AGCCCTCGCCAGGGCCCCGCGGG - Intronic
1175922509 20:62456774-62456796 AGCCCTGGCCGTAGCCCAGGTGG - Intergenic
1176053705 20:63134040-63134062 CGGCATCCCCAGAGCCCAGCGGG + Intergenic
1177176112 21:17702304-17702326 CTCCCTCCCCAGAGGTCAGGAGG + Intergenic
1178473623 21:32917486-32917508 CCCCCTGCTCAGAGCCCAGGAGG + Intergenic
1178924365 21:36762480-36762502 CACCCTCCCCAGACCCAAGGCGG - Intronic
1179893703 21:44350284-44350306 CGCCCTCGCCCCGGCCCCGGCGG - Intronic
1183055116 22:35300341-35300363 GGAGCTGGCCAGAGCCCAGGCGG - Intronic
1183264453 22:36816808-36816830 CGACCTCGCCGGCGCCCAGCGGG + Intronic
1183684001 22:39351083-39351105 CCCCCTCTCCAGACCCCAGCAGG - Intronic
1184677807 22:46053210-46053232 CTCCCATGCCAGGGCCCAGGGGG - Intronic
1185117197 22:48944658-48944680 CGCCCTTGCTAGAGGCCAGCTGG + Intergenic
950096969 3:10336072-10336094 TGCCCACGCCAGCTCCCAGGCGG - Intronic
950858463 3:16126956-16126978 AGCCCACGCCTCAGCCCAGGTGG - Intergenic
953909745 3:46885812-46885834 CTCCCTCTCCTGAGCCCAGAGGG + Intronic
956678227 3:71754486-71754508 GGCCAGCGCCAGCGCCCAGGCGG - Exonic
956733449 3:72217690-72217712 GGACCTCGCTTGAGCCCAGGAGG - Intergenic
962315071 3:134354142-134354164 AGCCTGGGCCAGAGCCCAGGTGG - Intergenic
963103375 3:141625473-141625495 GGGCCCAGCCAGAGCCCAGGGGG + Intergenic
966684915 3:182683012-182683034 CCCCTTGGCCAGAGCCGAGGCGG - Intergenic
968512832 4:1002976-1002998 CGCCCCCTCCAGAGCCCCAGCGG - Intronic
969486841 4:7477108-7477130 CCCCCTCCCCACGGCCCAGGTGG - Intronic
971749787 4:30632218-30632240 AGCCCACGGCAGTGCCCAGGTGG - Intergenic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
974969154 4:68803535-68803557 AGGCCGCGCCAGTGCCCAGGAGG - Intergenic
975004707 4:69270521-69270543 AGGCCGCGCCAGTGCCCAGGAGG - Intergenic
975013127 4:69379501-69379523 AGGCCGCGCCAGTGCCCAGGAGG - Intronic
977055850 4:92189441-92189463 GGCCCTCACCAGTGCCCAGCTGG - Intergenic
979690452 4:123553564-123553586 CGGCCTGGCCAGACCCCAGGTGG - Intergenic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
982343729 4:154333108-154333130 TGCCATCGACAGAGCCCTGGGGG - Exonic
985773213 5:1825732-1825754 CGCCCTGGCCACTCCCCAGGTGG - Intergenic
989147052 5:38259010-38259032 CGCCCTCCCCCGAGCCCGGGCGG + Intronic
997220277 5:132156806-132156828 GGCACCCGCCAGAGGCCAGGCGG + Intergenic
998150951 5:139757159-139757181 CCCCCATCCCAGAGCCCAGGAGG - Intergenic
998825929 5:146101306-146101328 AGTCCTCGCCAGAGCCCAATTGG + Intronic
999721199 5:154400468-154400490 CACCAGCTCCAGAGCCCAGGAGG + Intronic
1004041064 6:11976031-11976053 CGCCCTCGCCAGAGGCAAGAAGG - Intergenic
1004483206 6:16040462-16040484 TGGCCTCGCAAGAGCCCATGGGG + Intergenic
1004690391 6:17987835-17987857 CGGCCTCTCCCGAGCCCCGGCGG - Intergenic
1006171677 6:32096805-32096827 CGCCCTCGCCACAGTCCCAGGGG + Intronic
1013412853 6:109897290-109897312 CCACCTCCCCAGAGACCAGGAGG - Intergenic
1015539115 6:134296937-134296959 CGGCTGCCCCAGAGCCCAGGAGG - Intronic
1016433056 6:144008105-144008127 CGGCCTCGCCTGAGCTCCGGGGG - Intronic
1018058337 6:160071082-160071104 CCCCATGTCCAGAGCCCAGGAGG + Intronic
1020237069 7:6364508-6364530 CTCCATCGCTTGAGCCCAGGAGG + Intergenic
1023168124 7:37363279-37363301 GGCTCTTGCAAGAGCCCAGGTGG - Intronic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1028684172 7:93574664-93574686 CTACCTCCCCAGAGTCCAGGAGG + Intronic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1029439765 7:100581019-100581041 GGCCAGTGCCAGAGCCCAGGTGG - Intronic
1031903574 7:127436989-127437011 GGCCATCACCTGAGCCCAGGAGG - Intergenic
1033742533 7:144285596-144285618 CTCCCTCGCTAGAGCCCATCAGG - Intergenic
1033751370 7:144364018-144364040 CTCCCTCGCTAGAGCCCATCAGG + Exonic
1035470329 7:159105246-159105268 CCCCCACAGCAGAGCCCAGGAGG + Intronic
1036176007 8:6539172-6539194 ACCCCTCGCCAGAGCCTGGGGGG + Intronic
1037879343 8:22565492-22565514 CGAGCCCGCCAGCGCCCAGGAGG - Intronic
1039693077 8:39882215-39882237 AGGCCACGCCAGTGCCCAGGAGG + Intergenic
1041355204 8:56993195-56993217 CGCCTTCCCCAGCGTCCAGGTGG - Exonic
1044999644 8:97868845-97868867 CGTCCGTGCCTGAGCCCAGGCGG - Intronic
1046547163 8:115667708-115667730 CGCCTTCTCCAGAGCCCAGCTGG + Intronic
1049033799 8:140058796-140058818 CACTCTGGCCAGAGCCCATGTGG - Intronic
1049283725 8:141763383-141763405 CTCCCGCCCCAGAGCCGAGGTGG + Intergenic
1049610762 8:143553730-143553752 TGTCCTCGCCAGCGCCCAGCTGG + Exonic
1055783254 9:79843002-79843024 CGGCCTGCACAGAGCCCAGGAGG - Intergenic
1058735758 9:107892556-107892578 CGTGCTCGCCTGAACCCAGGAGG + Intergenic
1058980159 9:110161545-110161567 CTCCCTCGTCAGAACCCTGGGGG - Intronic
1059646165 9:116270091-116270113 CTCCCTCCCCAGAGACCAGCTGG - Intronic
1062128793 9:134881380-134881402 TGCCATCTCCAGAGCCCAGCAGG - Intronic
1062461927 9:136665863-136665885 CGCCCTCGACCCAGCCCGGGCGG - Intronic
1062533134 9:137010449-137010471 CCCCACCTCCAGAGCCCAGGGGG + Intronic
1189607892 X:42699472-42699494 CCCCCTCAACAGATCCCAGGAGG + Intergenic
1193215612 X:78860609-78860631 TGCCCTCACCAGAGGCCAAGTGG - Intergenic
1196290140 X:113930123-113930145 CACCCTCCCCGAAGCCCAGGTGG - Intergenic
1200138697 X:153886762-153886784 TGCGCACCCCAGAGCCCAGGTGG + Intronic