ID: 1076146474

View in Genome Browser
Species Human (GRCh38)
Location 10:128126243-128126265
Sequence TGCAGCGAACGCGACCCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076146474_1076146486 23 Left 1076146474 10:128126243-128126265 CCCGCGGGGTCGCGTTCGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1076146474_1076146484 21 Left 1076146474 10:128126243-128126265 CCCGCGGGGTCGCGTTCGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG 0: 1
1: 0
2: 2
3: 28
4: 218
1076146474_1076146485 22 Left 1076146474 10:128126243-128126265 CCCGCGGGGTCGCGTTCGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG 0: 1
1: 0
2: 2
3: 34
4: 642
1076146474_1076146490 29 Left 1076146474 10:128126243-128126265 CCCGCGGGGTCGCGTTCGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1076146490 10:128126295-128126317 CGCCGCCTCTGACGGGGACCCGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076146474 Original CRISPR TGCAGCGAACGCGACCCCGC GGG (reversed) Exonic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG + Intergenic
1070813852 10:79311454-79311476 TGCTGCGCAAGGGACCCCGCAGG - Intronic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1076594412 10:131617153-131617175 TGCACGGGACGCCACCCCGCCGG + Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077419846 11:2445027-2445049 TGCAGCGAAGGCGAGCGCCCGGG - Exonic
1091373276 12:10717-10739 TGAAGAGAACGCAACTCCGCCGG + Intergenic
1114597583 14:23926596-23926618 TGCAGCTAACCCAACCCCACTGG + Intergenic
1130283883 15:82540117-82540139 TGGTGCGAACGCGGCCCTGCGGG + Exonic
1132839534 16:1972328-1972350 CGCAGCCTCCGCGACCCCGCGGG - Intronic
1133288855 16:4704699-4704721 AGCAGCGCACCCGACCCAGCTGG + Intronic
1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG + Intergenic
1170969270 20:21102856-21102878 TGCAGCGAACCCCAGCTCGCCGG + Intergenic
1171037703 20:21729219-21729241 TGCAGCTAAGGCCACCCCTCAGG + Intergenic
1181042001 22:20196700-20196722 TGCAGTGAGCGAGACCCCGTGGG - Intergenic
968479506 4:826999-827021 TGCAGCGGACGCGGCACTGCGGG + Intergenic
976398578 4:84583171-84583193 TGCAGCGAGCGCGGCTCCGGCGG - Exonic
990984082 5:61626034-61626056 TGCAGCGACCACGGCCCCTCAGG - Intergenic
997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG + Intronic
1008708470 6:54193867-54193889 TGCAGGGAAAAAGACCCCGCTGG - Intronic
1014035717 6:116765257-116765279 TGCAGCGAAAGCAACCCAGATGG + Intronic
1019344018 7:520905-520927 TGCACAGCACGCCACCCCGCTGG - Intergenic
1022088808 7:27094656-27094678 TGCAGCGATCTCCACCCTGCGGG + Exonic
1039454522 8:37698096-37698118 TGCAGCGCGCACGACCCTGCCGG + Exonic
1203781098 EBV:101257-101279 TGCAGGGAATGCGGCCCCGGCGG + Intergenic
1203377183 Un_KI270442v1:385308-385330 TGCAGAGATCGCGACCCCGGAGG - Intergenic