ID: 1076146484

View in Genome Browser
Species Human (GRCh38)
Location 10:128126287-128126309
Sequence GCTCCCGCCGCCGCCTCTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076146473_1076146484 27 Left 1076146473 10:128126237-128126259 CCGCAGCCCGCGGGGTCGCGTTC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG 0: 1
1: 0
2: 2
3: 28
4: 218
1076146475_1076146484 20 Left 1076146475 10:128126244-128126266 CCGCGGGGTCGCGTTCGCTGCAC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG 0: 1
1: 0
2: 2
3: 28
4: 218
1076146474_1076146484 21 Left 1076146474 10:128126243-128126265 CCCGCGGGGTCGCGTTCGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG 0: 1
1: 0
2: 2
3: 28
4: 218
1076146479_1076146484 -4 Left 1076146479 10:128126268-128126290 CCGGCCTGCAGTCCCCGCTGCTC 0: 1
1: 2
2: 40
3: 696
4: 2581
Right 1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG 0: 1
1: 0
2: 2
3: 28
4: 218
1076146480_1076146484 -8 Left 1076146480 10:128126272-128126294 CCTGCAGTCCCCGCTGCTCCCGC 0: 1
1: 0
2: 3
3: 71
4: 1103
Right 1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG 0: 1
1: 0
2: 2
3: 28
4: 218
1076146478_1076146484 -3 Left 1076146478 10:128126267-128126289 CCCGGCCTGCAGTCCCCGCTGCT 0: 1
1: 1
2: 11
3: 129
4: 1296
Right 1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG 0: 1
1: 0
2: 2
3: 28
4: 218
1076146477_1076146484 -2 Left 1076146477 10:128126266-128126288 CCCCGGCCTGCAGTCCCCGCTGC 0: 1
1: 0
2: 0
3: 52
4: 594
Right 1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG 0: 1
1: 0
2: 2
3: 28
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076146484 Original CRISPR GCTCCCGCCGCCGCCTCTGA CGG Exonic
900109377 1:999139-999161 GCTCGCGCCGCCGCTGCTGCCGG - Exonic
900249299 1:1658929-1658951 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
900283776 1:1890022-1890044 GCTCCCACCGCTGCCTTTGTGGG - Intronic
900929321 1:5726354-5726376 GCTCCTGCAGCTGCCTCTGCTGG - Intergenic
901637738 1:10678134-10678156 GCCCACGCCGCCGCCTCTCCTGG - Intronic
902508973 1:16955353-16955375 GCTCCCGCCGCAGCCCGTCACGG - Exonic
903829120 1:26164414-26164436 GCCGCCGCCGCCGCCTGCGAGGG + Intergenic
904642059 1:31938374-31938396 GCTCCCGCCGCCGCCCCTCAGGG + Exonic
904837745 1:33349915-33349937 GCTCCCGCGGCCGCCTCCGCCGG + Intronic
905824082 1:41016213-41016235 GCTCCACCAGCCACCTCTGAGGG + Exonic
906277055 1:44524248-44524270 GCCGCCGCCACCGCCTCTGCTGG + Intronic
906624486 1:47313984-47314006 GGCCCCGCTGCCGCCTCTCAAGG + Intronic
908131842 1:61082375-61082397 GCTCGCGCCGCCGCCGCGGGGGG - Intronic
910759000 1:90717596-90717618 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
913281211 1:117186782-117186804 CCTCCCGCCCCAGCCTCTCAAGG - Intronic
915070490 1:153261674-153261696 GCTCCCGCCGCCCCCGCCGCTGG - Exonic
915275209 1:154783738-154783760 GCTCCGGCCTCCCCCTCTCATGG - Intronic
915605214 1:156946126-156946148 GCTGCAGCCGCCGACACTGAGGG + Exonic
916179322 1:162070133-162070155 CCTGCAGCCGCCGCCTCCGAAGG + Exonic
920331451 1:205211317-205211339 GGCCCCGCCGCCGCCCGTGAGGG + Exonic
921702431 1:218283672-218283694 CCTCCCGCCTCCGCCTCCCAAGG + Intergenic
922551530 1:226497884-226497906 GCTCCCTAGGCCGCCTCTGATGG + Intergenic
922867400 1:228871905-228871927 GCTCCCACAGCCGCCTCTTTCGG + Intergenic
923163414 1:231337387-231337409 GGAGCCGCCGCCGCCTCTGGAGG - Exonic
923191777 1:231626902-231626924 GCTCACGCCGCCGCCGCCGGCGG - Exonic
923506403 1:234609608-234609630 GCGGCCGCCGCCGCCGCTGGTGG - Intergenic
1064208825 10:13347390-13347412 GCCCTCGCCGCCGCCTCGGAAGG + Intronic
1064712434 10:18140767-18140789 GCCACCGCCGCCGCCGCTGTGGG - Exonic
1065005665 10:21377877-21377899 GCACCCGCCTCCGCCTCCCAAGG + Intergenic
1068962687 10:62881347-62881369 CCTCCCACCTCAGCCTCTGAAGG + Intronic
1069902705 10:71715201-71715223 GCACCCGCCCTGGCCTCTGAAGG + Exonic
1074722120 10:116272606-116272628 GCTGCCGCCGCCGCCACCGAGGG - Intronic
1075096204 10:119473273-119473295 GGTCCCACCTCCGCCTCTCAGGG - Intergenic
1075125135 10:119693408-119693430 GCTCTCCCCACCGCCTCTCAGGG - Intergenic
1076110593 10:127856353-127856375 GCTCCCTCCGAAGCCTCTGGGGG + Intergenic
1076146484 10:128126287-128126309 GCTCCCGCCGCCGCCTCTGACGG + Exonic
1076762337 10:132611803-132611825 CCTCCCGCACCCTCCTCTGATGG - Intronic
1076996045 11:298096-298118 GCTCCCGCCACTGACTCTGGGGG + Intergenic
1083883933 11:65561666-65561688 CCTCCCACCGCCGCCTCAGTAGG + Intergenic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1084129037 11:67119341-67119363 GCCGCCGCCGCCGCCGCTGCCGG - Intronic
1084131994 11:67143248-67143270 CCTCCCGCCTCCGCCTCCCAAGG + Intronic
1084181960 11:67451325-67451347 GCGCCCGGGGCCGCCTCTGGCGG + Exonic
1084546224 11:69816447-69816469 ACTCCCGCCGCCCCCACGGAGGG + Intronic
1089624306 11:119741548-119741570 GCTCCAGCCACCGCCTCTGTCGG + Intergenic
1092572503 12:9740078-9740100 GCTCTCGGCGCCTCCTCTGCCGG - Intergenic
1092860736 12:12717302-12717324 GCTCCCGCCGCCGCAACCAATGG + Exonic
1096241186 12:49961311-49961333 GCCCCCGCCGCCGGCGGTGAGGG + Intergenic
1096710466 12:53452108-53452130 GCTCCGGCTGCTGCCTCTGCTGG - Exonic
1098426062 12:70366538-70366560 GCTGCCGCCGCCGCCGCCGGGGG + Exonic
1100977954 12:100142300-100142322 GCTCCCGGCGCGGCGTCTGGGGG - Intronic
1101592694 12:106138565-106138587 GCCCCCGCCACCGCCTCTCGGGG + Exonic
1101935359 12:109052621-109052643 GCTACCGCCGCCGCCGCCGCCGG - Exonic
1103521248 12:121537911-121537933 GCCGCCGCCGCCGCCGCCGAGGG - Intronic
1103954196 12:124567435-124567457 CCTCCCGCCGCCGCCTCCTAGGG + Intronic
1105505150 13:21003547-21003569 CCTCCCGCCTCAGCCTCTCAAGG + Intronic
1106340285 13:28820399-28820421 GCCGCCGCCGCCGGCTCTCAGGG + Exonic
1108228931 13:48318072-48318094 GCCTCTGCCTCCGCCTCTGAAGG - Intronic
1108541494 13:51451731-51451753 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
1110558468 13:76886095-76886117 GCCCCCGCCGCCGCCCCCGTTGG + Exonic
1112157431 13:96833072-96833094 GCTCCTCCCGCCGCTTCTGGCGG - Exonic
1112505231 13:99971112-99971134 GCTGCCGCCGCCGCCACTGTTGG + Exonic
1113589767 13:111490090-111490112 TCTCCCGCCTCAGCCTCTCAAGG - Intergenic
1113656100 13:112068502-112068524 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1114563817 14:23613346-23613368 TCTCCCACCTCAGCCTCTGAAGG - Intergenic
1114866200 14:26598002-26598024 GCTGCCGCCGCCGCCGCTGCCGG + Intergenic
1117675609 14:58152152-58152174 GCTACCGCCGCCGCCGCCGCAGG - Exonic
1117978696 14:61321676-61321698 CCTCCTGCCCCCGCCTCCGAAGG - Intronic
1119296869 14:73539688-73539710 GCTTCAGCCGCCGCTTCTCAGGG - Intronic
1121029972 14:90649903-90649925 GCTCCCACCCCCGCCCCAGAGGG + Intronic
1121417476 14:93788946-93788968 CCTCCCGCCGCTGCCTCTCGCGG - Intergenic
1121491277 14:94363227-94363249 GTCCCCGCCGTCGCCTCTGACGG + Intergenic
1126163237 15:45632858-45632880 CCTCCCGCCTCAGCCTCTCAAGG - Intronic
1129644692 15:77419720-77419742 GCTCCCGGGGCCGCCGCCGAGGG + Intronic
1132055305 15:98647662-98647684 GCGCCCGCCGCGCCCTCTGGCGG + Intergenic
1132646114 16:1000047-1000069 GCACCTGCCGCCCCCTGTGAGGG + Intergenic
1132779297 16:1614165-1614187 GCTCCCTGCGCCGCCTCGGCCGG - Intronic
1132983734 16:2752818-2752840 CCTCCGCCCGCCGCCTCCGAGGG - Exonic
1133156581 16:3880501-3880523 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
1134005862 16:10818537-10818559 GCTCCGCCCGTCGCCGCTGAAGG + Exonic
1134636151 16:15793534-15793556 CCTCCCGCCTCGGCCTCTCAAGG + Intronic
1135298308 16:21301846-21301868 GCCTCCGCCTCCGCCGCTGAAGG - Intronic
1135717486 16:24784243-24784265 CCTCCCGCCTCGGCCTCTCAAGG + Intronic
1136146667 16:28320400-28320422 GCGCCCGACGCCGCCTCCCACGG - Exonic
1136478414 16:30526850-30526872 GCTCGCGCCGCGGCCTCTCTAGG + Intronic
1138360769 16:56425506-56425528 GCTCCCGCTGCTGCCCCTGCCGG + Exonic
1139712987 16:68790627-68790649 CCTCCAGCCTCCGCCTCTGCAGG + Intronic
1140561152 16:75983397-75983419 GCTCCTGCCACTGCCTCAGATGG - Intergenic
1141107738 16:81247417-81247439 ACTCCTGCCTCCGCCTCTCAAGG - Intronic
1141682597 16:85553294-85553316 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
1142336163 16:89490573-89490595 GCTCCCGCCGCAGCCGCCGCTGG - Intergenic
1142413136 16:89926190-89926212 GCTCCCCCCTCCGCCGCTGCAGG - Intronic
1144724541 17:17495260-17495282 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1145917909 17:28587168-28587190 CCTCCTGCCTCAGCCTCTGAAGG - Intronic
1146917999 17:36690441-36690463 TCTCCAGCCGCTGCCTCTGCTGG - Intergenic
1147636361 17:41966849-41966871 GCCACCGTCGCCGCCTCTGCCGG - Exonic
1147651182 17:42062837-42062859 GCTGCCGAAGCCGCCTCTGGTGG + Exonic
1149868244 17:60162255-60162277 CCTCCCGAGGCCGCCACTGATGG + Intronic
1150423170 17:65056600-65056622 GCCGCCGCCGCCGCCTCGGCGGG + Exonic
1150768283 17:68020077-68020099 GCGCGCGCCGCCGCCGCTGGGGG - Intergenic
1152521034 17:80857167-80857189 CCTCCCTCCCCTGCCTCTGAGGG + Intronic
1152597635 17:81245750-81245772 GGTCCCGCCGTCGCCTCCGGAGG + Exonic
1152797668 17:82316077-82316099 GTACCCGCCGCCTCCTCTGCAGG - Intronic
1152928669 17:83099342-83099364 GCACCCGGTGCCGCCTCAGAAGG - Intergenic
1154156921 18:11951113-11951135 CCTCCCGCCTCCCTCTCTGAAGG - Intergenic
1159704756 18:71673878-71673900 GCTCCAGCCACAGCCTCTCACGG - Intergenic
1160858677 19:1228547-1228569 GCTGCTGCCGCCGGCCCTGAGGG - Exonic
1161374919 19:3934467-3934489 GCTCACACCCCCGCCTCAGAAGG + Intronic
1162380493 19:10329037-10329059 GCTCCCGCAGGCGGCTCTGGTGG + Exonic
1162795989 19:13088030-13088052 GCTACCGCCGCCGCCTCCAGTGG + Intronic
1163681246 19:18683852-18683874 CCTCCCTCCGCCGGCCCTGAAGG - Intronic
1163740729 19:19010149-19010171 GCCCCCGCCGCTGCCACGGAAGG + Exonic
1163851112 19:19664044-19664066 GCTCCCGACCCCGCCTCCGCAGG - Intergenic
1164594850 19:29526118-29526140 GCTCCCGCAGCCGCCCCCGCCGG - Intergenic
1164834534 19:31349244-31349266 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1165115142 19:33523968-33523990 GCCCCTGCCACAGCCTCTGATGG - Intergenic
1165498134 19:36166280-36166302 CCTCCCGCCTGAGCCTCTGAAGG + Intergenic
1166078103 19:40425624-40425646 GCCCCCGCCGCCGCCGCTTCGGG - Intronic
1167310568 19:48735360-48735382 GCCGCCGCCGCCGCCCCTGAAGG + Exonic
1167622769 19:50568361-50568383 GCCCCGGCCCCCGCCTCGGACGG + Intergenic
1167798115 19:51724024-51724046 GCTCCCGCCCCCGCCTGCGCTGG - Intergenic
1168146011 19:54420519-54420541 GCTCCCGCCCCCTCCACTGCGGG + Intronic
925906549 2:8543201-8543223 GGTCCTGCCCCCGCCTCTGAGGG + Intergenic
927495157 2:23547009-23547031 GCTCCCTCAGGCGGCTCTGATGG - Intronic
929126814 2:38529747-38529769 GCTCCTGCCGCCTCCTCTGACGG - Intergenic
931253507 2:60552418-60552440 GCCGCCGCCGCCGCCGCCGAAGG - Intronic
932437973 2:71714213-71714235 TCTCCCGCCCACTCCTCTGATGG + Intergenic
932577323 2:72969981-72970003 GCTCCTGGAGCCTCCTCTGAGGG - Intronic
933837310 2:86256422-86256444 GCTCCAGCCACTGCCTCTGATGG + Intronic
936594185 2:113832015-113832037 CCGCCCGCCTCGGCCTCTGAAGG + Intergenic
942004913 2:171688059-171688081 GCTCCCCAGGCCGCCTCTGGAGG - Intronic
944743729 2:202635607-202635629 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
946191624 2:218010617-218010639 GCGCCGGGCGCCGCCTCTGCCGG - Intergenic
948256035 2:236568517-236568539 CGTCCCGCCACCGCCTCTGCAGG - Intronic
948461226 2:238130878-238130900 GCTGCGGCACCCGCCTCTGATGG - Exonic
948822524 2:240557390-240557412 GCTCCCGCCGCGAACTCAGAGGG + Intronic
949014044 2:241699517-241699539 CCTCCCGCCTCAGCCTCTCATGG + Intergenic
949057769 2:241937838-241937860 TCTCCCGCCTCAGCCTCTGAAGG + Intergenic
1168771181 20:417887-417909 GCTCCCGCTGCAGCTCCTGAGGG - Exonic
1169365171 20:4986216-4986238 CCTCCTGCCCCCGCCTCTGCTGG - Intronic
1171051639 20:21865019-21865041 GGTCCTGCCGCTGTCTCTGAGGG + Intergenic
1171981762 20:31633545-31633567 TCTTCCGCCCCCGCCTCTGTGGG - Intergenic
1172037310 20:32019123-32019145 GCTGCCGCCGCCGCCTCCCCCGG - Exonic
1173210488 20:41028475-41028497 GGTCCCGCCGCGGCCTTTAAAGG + Intergenic
1173243434 20:41317604-41317626 GCCGCCGCCGCCGCCTCTGCGGG - Intronic
1173414445 20:42843378-42843400 GCTCCCACCACGGCCTCTGCTGG + Intronic
1174357822 20:50010100-50010122 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1174467919 20:50731643-50731665 GCTGCGGCCGCCCCCTCTGCAGG + Exonic
1174475077 20:50790753-50790775 GCTCCCGCCTCCTGCTCTGGAGG - Intergenic
1174494731 20:50931312-50931334 GTTGCCGCCGCCGCCTCCGCCGG - Intergenic
1178703723 21:34855594-34855616 TCTCCCGCCTCAGCCTCTGGAGG - Intronic
1178744561 21:35236551-35236573 TCTCCTGCCTCAGCCTCTGACGG + Intronic
1179810985 21:43869609-43869631 GCTCCCTCCGCCTCCTCTCACGG - Intronic
1180147837 21:45931058-45931080 GCTCCCACGGCCGCCTCCCATGG - Intronic
1181572029 22:23772939-23772961 GCTCCAGCCGCCGCCGCTGCTGG + Exonic
1181934454 22:26429111-26429133 GCGCCCGCCGCCGCTCCGGAGGG - Intergenic
1182532303 22:30969627-30969649 GCTGCCGCCGCCGCCTCCCCCGG - Intergenic
1183669568 22:39264562-39264584 TCTCCCCTCCCCGCCTCTGAGGG + Intergenic
1183707969 22:39486742-39486764 CCTCCTGCCTCAGCCTCTGAAGG + Intronic
1184357508 22:43992424-43992446 GCAGCCGCCGCCATCTCTGAAGG - Intronic
1185313766 22:50170317-50170339 GATCCCGCCGCCGCCCCCGCCGG + Intergenic
949414383 3:3799850-3799872 GCTGCCGCCGCCGCCGCCGTGGG + Exonic
949970239 3:9397670-9397692 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
950040625 3:9917177-9917199 GCCCCCTCCGCCCCCTCTGGAGG + Exonic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
954687455 3:52378540-52378562 GCTCCCTCTGCCGCCTCTGCAGG - Intronic
955203471 3:56874133-56874155 TCTGACGCTGCCGCCTCTGATGG - Intronic
957630874 3:82715208-82715230 GCTCTCGGCGCCTCCTCTGTGGG + Intergenic
961322269 3:126084099-126084121 TTTCCCGCCGCCGCCTGGGAGGG - Exonic
963253093 3:143120069-143120091 GCAGCCGCCGCCGCCGCTGCGGG + Exonic
964720622 3:159764765-159764787 GCCCCCGCCGCCGCCGCTGCGGG - Exonic
967493705 3:190120662-190120684 GCTACTGCCGCCGCCACTGTGGG - Exonic
968835882 4:2963878-2963900 GCCGCCGCCGCCGCCTCCGCAGG - Exonic
970195212 4:13544910-13544932 GCTACCGCCGCCGCCGCCGGGGG - Exonic
971196155 4:24472739-24472761 GCCGCCGCCGCCGCCTGTGCCGG + Intergenic
976389364 4:84493328-84493350 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
981300912 4:143185114-143185136 GCTCCCGCCGACGCCGCTGGGGG + Exonic
982202890 4:152976023-152976045 CCTCCAGCCGGCGCCTCTGCTGG - Exonic
983923433 4:173371258-173371280 GCGGCCGCCGCCGCCTCGGCGGG + Exonic
984811217 4:183797755-183797777 TCCCCCGCCGGCGCCTCTGCCGG - Intergenic
984818223 4:183857820-183857842 GCTCCCTCCCATGCCTCTGAGGG + Intronic
985643417 5:1074202-1074224 GCCCCCGCCGAGGCCCCTGAGGG + Intronic
986774594 5:11002345-11002367 GCTCCCGCCTCCCTCTATGAAGG + Intronic
987282834 5:16427728-16427750 GTTCCAGCAGCCGCCTCTGTTGG - Intergenic
991388229 5:66113831-66113853 CCTCCCACCTCAGCCTCTGAAGG - Intergenic
991489023 5:67165575-67165597 CATCCCTCCGCCCCCTCTGACGG + Exonic
994628962 5:102257725-102257747 TCTCCCACCTCAGCCTCTGAAGG + Intronic
995571697 5:113488355-113488377 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
996442955 5:123512490-123512512 GCTGCCCCCGCCGGCGCTGACGG + Intronic
997297527 5:132777270-132777292 TCTCCCGCCGCCGCCGCCAAGGG - Exonic
998199415 5:140107826-140107848 GCCGCCGCCGCCGCCGCAGACGG - Intronic
998914579 5:146999952-146999974 GCTCCACCCTCAGCCTCTGATGG + Intronic
1001122745 5:168993538-168993560 GCTCCCACAGCCTGCTCTGAAGG + Intronic
1002194824 5:177496160-177496182 GCTCCTGTGGCCACCTCTGAGGG - Intronic
1002433908 5:179219948-179219970 TCACCCGCCCCAGCCTCTGAAGG - Intronic
1003305168 6:4920725-4920747 TCTCCTGCCTCCGCCTCTGGAGG + Intronic
1004562265 6:16761649-16761671 GCTGCCGCCGCCGCAGCTCAAGG + Intergenic
1005725130 6:28640241-28640263 GCTCTCGGCGCCTCCTCTGCCGG - Intergenic
1006071302 6:31499410-31499432 TCCCCCGCCCCCGCCACTGAAGG + Intronic
1006302353 6:33200322-33200344 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1009975711 6:70668316-70668338 GACCTCGCCGCCGCCTCTGGCGG - Intronic
1012399997 6:98835070-98835092 GCCCCCGCCGCCGCCGCCGTGGG - Exonic
1012929563 6:105302837-105302859 GCCCCCGCCGCCTGCTCCGAGGG + Intronic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013575992 6:111483621-111483643 GCTGCCCCCGCCTCCTCTGCTGG - Exonic
1015148928 6:130018509-130018531 GCCGCCGCCGCCGCCGCTGCCGG - Exonic
1019192560 6:170261628-170261650 CCTCCCGCCTCAGCCTCTCAAGG - Intergenic
1020065744 7:5187283-5187305 CCTCCCGCCTTAGCCTCTGAAGG + Intergenic
1020727338 7:11832143-11832165 GCCGCCGCCGCCGCCTCTGGCGG + Exonic
1022715064 7:32891598-32891620 GCCCCCGCCGCCGCGCCGGAGGG - Exonic
1023054982 7:36283980-36284002 GCTGCTGCCGCCGCCACTGGGGG - Intronic
1025106446 7:56175130-56175152 GCTCCGGCCTCGGCCTCTGCGGG + Intergenic
1031604144 7:123748695-123748717 GCAGCCGCCGCCGCCGCGGAGGG - Exonic
1031604229 7:123749033-123749055 GCGGCCGCCGCCGCCGCTGCGGG - Exonic
1031899309 7:127392377-127392399 GCTGCCGCCGCCACCACCGAAGG + Exonic
1035169537 7:157009944-157009966 GCCGCCGCCGCCGCCGCTGGGGG - Exonic
1035224584 7:157426384-157426406 GCTCCCGTCGCCTCCTCTGCGGG + Intergenic
1035337956 7:158142208-158142230 ACGCCCGCCTCCGCCTCTGTGGG + Intronic
1035417847 7:158704771-158704793 GCACCCGCCGGCGCCCCAGACGG + Exonic
1036789545 8:11708835-11708857 GCAGCCGCCGCCGCCTCCGCCGG + Exonic
1036910648 8:12754944-12754966 GCGCCCGCTGCCGCCTCTGCCGG - Exonic
1040065595 8:43141298-43141320 GCCGCCGCCGCCGCCTGGGAGGG + Intronic
1041085623 8:54253858-54253880 CCTCCCGCCTCGGCCTCTCATGG + Intergenic
1041881074 8:62750581-62750603 GCACCCCCCGCCGCCTCCCAGGG - Intronic
1043464031 8:80487181-80487203 CCCGCCGCCGCCGCCTCGGAAGG - Exonic
1046654212 8:116874720-116874742 GCTCCCGCCGCCGCCACAGCCGG + Exonic
1048197736 8:132346404-132346426 GCTCCCGCCTCCGCCTCTCTAGG - Intronic
1049689337 8:143951884-143951906 GCTGCTGCCGCCCCCACTGAGGG + Intronic
1049760086 8:144328152-144328174 CCTCCCACCTCGGCCTCTGAAGG + Intergenic
1049784656 8:144444573-144444595 GCGCCCGCCGCCGCCGTCGAGGG - Intergenic
1050428731 9:5539614-5539636 GCTCCCGCCCCTTCCTCAGATGG - Intronic
1055514165 9:77020161-77020183 GCCCCCGCCGCCGCCGCACATGG + Exonic
1055906465 9:81300336-81300358 TCTCCTGCCTCAGCCTCTGAGGG + Intergenic
1057596122 9:96417659-96417681 GCCTCCGCCGCCGCCTCGGGAGG - Exonic
1059769832 9:117414794-117414816 GCTGCCGCCGCCGCCGCTGCTGG - Exonic
1060200890 9:121651416-121651438 GCTCCCACCCCCGCCCCCGAGGG - Intronic
1060596805 9:124853477-124853499 GGTCCCGCGGCCGCCTAGGAGGG + Exonic
1060979662 9:127785240-127785262 CCTCCCGCCTTCGCCTCTGTGGG + Intergenic
1061792248 9:133064867-133064889 GCTCCCCTCCCCGCCTCTGTGGG - Intronic
1062305982 9:135907390-135907412 CCTCCTGCCGCCGCCTCTTTGGG - Intergenic
1062399072 9:136364582-136364604 GCTCCGGCCGGCTCCCCTGAGGG + Intronic
1186107842 X:6226467-6226489 GCTCCCGCCCCCGCCGCTCCGGG + Intronic
1186496375 X:10015309-10015331 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1186660564 X:11664685-11664707 GCTCCCGCAGCCGCCGATCAGGG + Exonic
1187281539 X:17861234-17861256 GCTGTCGCCGCCGCCGCTGCTGG + Exonic
1187823018 X:23308421-23308443 GCTGCCGCTGGCACCTCTGAGGG - Intergenic
1188738069 X:33742416-33742438 GCCCCTTCCGCCGCCTGTGAAGG + Intergenic
1199771088 X:150975850-150975872 GCTCCCTTCCCCTCCTCTGAAGG + Intergenic
1200000217 X:153056316-153056338 GCTCTCGCCGCCGCCCCTGGGGG - Intergenic