ID: 1076146485

View in Genome Browser
Species Human (GRCh38)
Location 10:128126288-128126310
Sequence CTCCCGCCGCCGCCTCTGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 642}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076146478_1076146485 -2 Left 1076146478 10:128126267-128126289 CCCGGCCTGCAGTCCCCGCTGCT 0: 1
1: 1
2: 11
3: 129
4: 1296
Right 1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG 0: 1
1: 0
2: 2
3: 34
4: 642
1076146479_1076146485 -3 Left 1076146479 10:128126268-128126290 CCGGCCTGCAGTCCCCGCTGCTC 0: 1
1: 2
2: 40
3: 696
4: 2581
Right 1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG 0: 1
1: 0
2: 2
3: 34
4: 642
1076146477_1076146485 -1 Left 1076146477 10:128126266-128126288 CCCCGGCCTGCAGTCCCCGCTGC 0: 1
1: 0
2: 0
3: 52
4: 594
Right 1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG 0: 1
1: 0
2: 2
3: 34
4: 642
1076146480_1076146485 -7 Left 1076146480 10:128126272-128126294 CCTGCAGTCCCCGCTGCTCCCGC 0: 1
1: 0
2: 3
3: 71
4: 1103
Right 1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG 0: 1
1: 0
2: 2
3: 34
4: 642
1076146474_1076146485 22 Left 1076146474 10:128126243-128126265 CCCGCGGGGTCGCGTTCGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG 0: 1
1: 0
2: 2
3: 34
4: 642
1076146475_1076146485 21 Left 1076146475 10:128126244-128126266 CCGCGGGGTCGCGTTCGCTGCAC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG 0: 1
1: 0
2: 2
3: 34
4: 642
1076146473_1076146485 28 Left 1076146473 10:128126237-128126259 CCGCAGCCCGCGGGGTCGCGTTC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG 0: 1
1: 0
2: 2
3: 34
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076146485 Original CRISPR CTCCCGCCGCCGCCTCTGAC GGG Exonic
900091954 1:924513-924535 CTGCCGCTGCCGCCGCTGCCAGG + Intergenic
900109376 1:999138-999160 CTCGCGCCGCCGCTGCTGCCGGG - Exonic
901325136 1:8361015-8361037 CCCCCGCTGCAGCCTCTGACTGG - Exonic
901783269 1:11608618-11608640 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
902033369 1:13439145-13439167 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
902508972 1:16955352-16955374 CTCCCGCCGCAGCCCGTCACGGG - Exonic
902964030 1:19984951-19984973 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
904642060 1:31938375-31938397 CTCCCGCCGCCGCCCCTCAGGGG + Exonic
904837746 1:33349916-33349938 CTCCCGCGGCCGCCTCCGCCGGG + Intronic
905185904 1:36196826-36196848 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
906140411 1:43531001-43531023 CTGCCGCCGCCGCCTCCACCTGG - Exonic
906308705 1:44738187-44738209 CGCGCGCCGCCGCACCTGACTGG + Intergenic
910759002 1:90717597-90717619 CCGCCGCCGCCGCCGCTGCCGGG + Intergenic
911259677 1:95670127-95670149 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
912166072 1:107044615-107044637 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
912819449 1:112855014-112855036 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
914203506 1:145506352-145506374 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
914482628 1:148079506-148079528 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
914893983 1:151652042-151652064 CTCGCGCCGCCACACCTGACTGG - Intronic
914927991 1:151905997-151906019 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
915259975 1:154670611-154670633 CTCTCGACGCCTCCTCTGCCTGG + Intergenic
915666187 1:157446780-157446802 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
915865626 1:159495105-159495127 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
916219790 1:162433016-162433038 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
916904877 1:169272442-169272464 CTCCCCCCGCCCCCCATGACAGG + Intronic
917970233 1:180201477-180201499 CTCCCTCCACCACCTCTGAAAGG + Exonic
918792116 1:188841674-188841696 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
918993816 1:191731675-191731697 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
919236963 1:194858927-194858949 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
919333621 1:196204481-196204503 CTCCTCCCGCCCCCACTGACAGG + Intergenic
919486834 1:198157003-198157025 CTCCTGCTGCCGCCGCTGTCAGG - Exonic
919939465 1:202276363-202276385 CTCCCTCCGCCACCTCTGGCTGG + Exonic
920756607 1:208739541-208739563 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
921360839 1:214329835-214329857 CTCCCTCAGCTGCCTCTGCCTGG - Intronic
921396462 1:214673646-214673668 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
921983757 1:221286154-221286176 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
922056755 1:222049608-222049630 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
922307047 1:224352984-224353006 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
922485349 1:225969630-225969652 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
922541988 1:226426790-226426812 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
922674585 1:227542625-227542647 CCCTCGCCGCGGCCTCTGCCAGG - Intergenic
922985801 1:229865319-229865341 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
923623298 1:235594881-235594903 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
924117441 1:240762351-240762373 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
924219311 1:241856074-241856096 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1063685245 10:8230917-8230939 CTCCCGCCTCAGCCTCTCAGAGG + Intergenic
1064203011 10:13300110-13300132 CTCCAGGCGCCGCCCCGGACTGG + Intronic
1064460951 10:15534830-15534852 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1065743349 10:28816174-28816196 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1065895821 10:30162715-30162737 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1068204173 10:53827429-53827451 CCGCCGCCGCCGCCTCCGCCAGG - Exonic
1068373943 10:56154983-56155005 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1069186599 10:65429916-65429938 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1069766071 10:70861504-70861526 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1069915601 10:71784863-71784885 CTCCCTCCTCCTTCTCTGACTGG + Intronic
1069992896 10:72325816-72325838 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1070328335 10:75401885-75401907 CCGCCGCCGCCGCCGCTGCCAGG + Exonic
1070739949 10:78896347-78896369 CTCCAGCCGCTGCCCCTGTCTGG + Intergenic
1072402349 10:95117846-95117868 CTCTCCCCACCGCCCCTGACAGG + Intergenic
1074732404 10:116393265-116393287 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1074843214 10:117375226-117375248 ATCCCGCCACCGCCTCCGCCCGG + Exonic
1075255545 10:120923685-120923707 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1075474752 10:122724488-122724510 CTGCCGCTGCCTCCTCAGACAGG + Intergenic
1075697489 10:124447632-124447654 CGCCCCCCGCCGCCCCTGGCTGG + Exonic
1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG + Exonic
1076147392 10:128134837-128134859 CTCCCACCTCAGCCTCTGAGTGG + Intergenic
1076638891 10:131900933-131900955 CGCCCTCCGCCTCCTCGGACGGG - Exonic
1076673807 10:132137379-132137401 CTGCCGCGGCCGCTTCTGTCTGG - Intronic
1076762096 10:132611034-132611056 CTCCCTCATCCTCCTCTGACAGG - Intronic
1076762147 10:132611218-132611240 CTCCCTCATCCTCCTCTGACAGG - Intronic
1076762161 10:132611263-132611285 CTCCCTCATCCTCCTCTGACAGG - Intronic
1076762200 10:132611397-132611419 CTCCCACACCCTCCTCTGACAGG - Intronic
1076762323 10:132611757-132611779 CTCCCTCACCCTCCTCTGACAGG - Intronic
1076762352 10:132611847-132611869 CTCCCACACCCTCCTCTGACGGG - Intronic
1076762385 10:132611937-132611959 CTCCCACACCCTCCTCTGACAGG - Intronic
1077074681 11:694990-695012 CCACCGCCGCCGCCTCAGCCAGG + Exonic
1077194960 11:1274850-1274872 CCCCCGCCCCCGCCTGTGTCAGG - Exonic
1077208898 11:1359088-1359110 GCCCCGCCGCCGCCTCTGCACGG + Intergenic
1077552641 11:3207955-3207977 CACCCACAGCCTCCTCTGACAGG - Intergenic
1077680630 11:4237316-4237338 CTCGCGCCGCCACGCCTGACTGG + Intergenic
1077684911 11:4282714-4282736 CTCGCGCCGCCACGCCTGACTGG + Intergenic
1077690279 11:4335216-4335238 CTCGCGCCGCCACGCCTGACTGG - Intergenic
1077764514 11:5144275-5144297 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1077836933 11:5934161-5934183 CTCGCGCCGCCACGCCTGACTGG + Intronic
1079555500 11:21753617-21753639 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1080557765 11:33432243-33432265 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1080606654 11:33869721-33869743 GTCCCGCCGCCGCCACCGCCCGG + Exonic
1081576081 11:44319271-44319293 CTCCGGCTGCCTCCTATGACAGG - Intergenic
1083114838 11:60450840-60450862 CTCGCGCCGCCACGCCTGACTGG + Intronic
1083335061 11:61917434-61917456 CGCCCGCCGCCGACTCCGCCAGG + Exonic
1083546036 11:63550066-63550088 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1083609647 11:63998843-63998865 CTCCCGCAGCCCACCCTGACCGG - Exonic
1083841713 11:65308588-65308610 CTCCAGCTGCTGCCTCTGCCTGG - Intergenic
1083899787 11:65638095-65638117 CTCCCGGCGCCGGCTCCGCCTGG - Intronic
1084129035 11:67119340-67119362 CCGCCGCCGCCGCCGCTGCCGGG - Intronic
1084181961 11:67451326-67451348 CGCCCGGGGCCGCCTCTGGCGGG + Exonic
1084210384 11:67618900-67618922 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1084406151 11:68974740-68974762 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1084546225 11:69816448-69816470 CTCCCGCCGCCCCCACGGAGGGG + Intronic
1084891720 11:72240008-72240030 CTGCCGCCGCCGCCTGCGCCCGG - Exonic
1085447322 11:76609529-76609551 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1085609378 11:77933367-77933389 CGCGCGCCGCCACGTCTGACTGG + Intronic
1088570802 11:111221839-111221861 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1088892983 11:114059376-114059398 CGCCGGCGGCCGCCTCTCACCGG - Intergenic
1089456004 11:118626167-118626189 CTCCCTCCCCTGCCTCTGATTGG + Intronic
1090133630 11:124171197-124171219 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1090229148 11:125089357-125089379 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1091266762 11:134277047-134277069 CGCCCGCCTCCGCCTCTCCCAGG + Intronic
1092137355 12:6159340-6159362 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1092336599 12:7639701-7639723 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1092502649 12:9064541-9064563 CGCCCGCCGCCGCCGCGGAGTGG + Intergenic
1092572502 12:9740077-9740099 CTCTCGGCGCCTCCTCTGCCGGG - Intergenic
1092732394 12:11547153-11547175 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1093189322 12:16057243-16057265 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1093266200 12:17007485-17007507 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1093381487 12:18500008-18500030 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1093527164 12:20115728-20115750 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1093580227 12:20777911-20777933 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1093793644 12:23285806-23285828 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1095123023 12:38441813-38441835 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1095304086 12:40620542-40620564 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1095584553 12:43836015-43836037 CACCCGCCGCCGCCTACGCCGGG - Intronic
1097195430 12:57240186-57240208 CTCCCGGCTCCGCTTCTGTCTGG - Intronic
1097981938 12:65744220-65744242 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1098168292 12:67719731-67719753 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1100211962 12:92407018-92407040 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1101008909 12:100430162-100430184 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1103146222 12:118597675-118597697 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1103439312 12:120950843-120950865 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1103668467 12:122591885-122591907 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1103678790 12:122677097-122677119 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1103783476 12:123414613-123414635 CTCTCGGCGCCTCCTCTGCCTGG - Exonic
1105425569 13:20292277-20292299 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1105527227 13:21187254-21187276 CTCGCGCCGCCACGCCTGACTGG - Intergenic
1105876763 13:24561205-24561227 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1106272395 13:28167300-28167322 CTCCTGCCTCAGCCTCTGCCTGG + Intronic
1107836033 13:44413436-44413458 CTCTCGGCGCCGCCTCTGCCTGG + Intergenic
1108099257 13:46936554-46936576 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1108435266 13:50396455-50396477 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1108541496 13:51451732-51451754 CCGCCGCCGCCGCCGCTGCCGGG + Intronic
1108859036 13:54830000-54830022 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1110344098 13:74426217-74426239 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1111590947 13:90348461-90348483 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1111602656 13:90494680-90494702 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1111747615 13:92290749-92290771 CTCTCGGCGCCTCCTCTGTCTGG + Intronic
1112250478 13:97774618-97774640 CACGCGCCGCCACCCCTGACTGG + Intergenic
1112538204 13:100282308-100282330 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1112613021 13:100975557-100975579 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1112705782 13:102068335-102068357 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1112842626 13:103599842-103599864 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1114612495 14:24052006-24052028 CTCAAGCAGCCGCCCCTGACCGG + Exonic
1116452282 14:45080297-45080319 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1117297500 14:54393322-54393344 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1117302435 14:54442912-54442934 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1118239140 14:64038694-64038716 CGCCCGCCGCCACGCCTGACTGG - Intronic
1118593103 14:67415970-67415992 CTCCCGCCACATCCCCTGACAGG - Intergenic
1119038761 14:71254155-71254177 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1119254738 14:73185446-73185468 CTCACGCCGCCACGCCTGACTGG - Intronic
1119266030 14:73263793-73263815 GTCCCCCCACCTCCTCTGACAGG + Intronic
1119266088 14:73264023-73264045 CTCCCTCCACCTCCGCTGACAGG + Intronic
1120248102 14:82029221-82029243 CCCCCGCAGCTGCCTCTGAAAGG - Intergenic
1120330910 14:83092245-83092267 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1120844085 14:89111508-89111530 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1121350730 14:93170583-93170605 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1121417475 14:93788945-93788967 CTCCCGCCGCTGCCTCTCGCGGG - Intergenic
1121491278 14:94363228-94363250 TCCCCGCCGTCGCCTCTGACGGG + Intergenic
1122228413 14:100292885-100292907 CGCCCGCCGCCGCACCTGCCAGG + Exonic
1122390045 14:101373880-101373902 CTCCTGCTGCCGCCTCCGCCAGG - Intergenic
1122843516 14:104478004-104478026 CCACGGCCGCCGCCTCTGAGTGG - Intronic
1123799061 15:23802774-23802796 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1124114937 15:26831679-26831701 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1124505247 15:30266984-30267006 CTCCTGCCTCAGCCTCTCACAGG - Intergenic
1124738305 15:32271651-32271673 CTCCTGCCTCAGCCTCTCACAGG + Intergenic
1124922263 15:34038760-34038782 CACCAGCCGTCGCCTCTTACCGG + Exonic
1125565828 15:40677427-40677449 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1125914627 15:43474378-43474400 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1126127999 15:45313953-45313975 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1126434722 15:48624845-48624867 CCCCCGGCTCCGCCTCTGGCCGG - Intronic
1126639597 15:50811837-50811859 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1126849793 15:52789927-52789949 CGCCCCTCGCCGCCTCTGCCTGG - Exonic
1127072749 15:55302228-55302250 CACCCGCCGCCACGCCTGACTGG + Intronic
1127982757 15:64046503-64046525 CTCCAGCCGGCGCCTGGGACGGG - Intronic
1128801635 15:70500833-70500855 CACCAGCAGCCTCCTCTGACTGG + Intergenic
1128813383 15:70587665-70587687 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1129287976 15:74541162-74541184 CCCCCGCCCCCGCCCCTGGCTGG + Exonic
1129424466 15:75454094-75454116 GTCCCGCCCCCGCCTCTGATTGG - Intronic
1129452034 15:75656511-75656533 CCTCCGCCCCAGCCTCTGACAGG - Intronic
1129777577 15:78246638-78246660 CTCTCGGCGCCTCCTCTGGCTGG - Intergenic
1129816756 15:78561973-78561995 CTCCTGCCCCAGCCTCTCACTGG - Intergenic
1129933607 15:79431902-79431924 CCTCCGCCGCAGCCTCTGGCAGG + Intergenic
1130979552 15:88803358-88803380 CTCCCGCCCCCACCCCTCACGGG + Intergenic
1131212621 15:90510820-90510842 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1131777025 15:95814027-95814049 CTCTCCCCACCGCCTCTGACAGG + Intergenic
1131846200 15:96492337-96492359 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1132648654 16:1010544-1010566 AGCCCGCCGCTGCCTCTGCCCGG - Intergenic
1132836896 16:1958671-1958693 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1132983733 16:2752817-2752839 CTCCGCCCGCCGCCTCCGAGGGG - Exonic
1133156582 16:3880502-3880524 CTGCCGCCGCCGCCGCCGCCGGG + Exonic
1133752238 16:8733672-8733694 CTCACGCCGCCACGCCTGACTGG - Intronic
1133963581 16:10515551-10515573 CTCCCGCCTCCGCCTTTCAAAGG - Intergenic
1134082918 16:11336554-11336576 CTCACGCCGCCACGCCTGACTGG - Intronic
1134134220 16:11668766-11668788 CCCCCGCCGCCTCCTTTGTCCGG - Intronic
1134163989 16:11915692-11915714 CCGCCGCCGCCGCCACTGCCCGG + Exonic
1135280776 16:21152458-21152480 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1135299467 16:21313280-21313302 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1135381185 16:21997416-21997438 CTGCCTCCCCCTCCTCTGACAGG - Intronic
1135751146 16:25059410-25059432 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1136103266 16:28010855-28010877 CGCCCGCAACTGCCTCTGACAGG + Intronic
1136146666 16:28320399-28320421 CGCCCGACGCCGCCTCCCACGGG - Exonic
1136559833 16:31032854-31032876 CTTCTGGCGCAGCCTCTGACAGG - Intergenic
1137493339 16:48951251-48951273 CTCGCGCCGCCACGCCTGACTGG + Intergenic
1138400720 16:56740866-56740888 CTCGCGCCGCCACGCCTGACTGG - Intronic
1138693679 16:58791285-58791307 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1139147661 16:64343756-64343778 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1139442235 16:66974141-66974163 CTCTCCCTGCCGCCTCTGCCTGG + Exonic
1139806001 16:69565971-69565993 CCACCGCCGCCGCCGCTGACAGG - Intronic
1139917840 16:70439137-70439159 CCGCCGCCGCCGCCTCAGCCCGG + Intronic
1140993939 16:80242697-80242719 CTCACGCCGCCTCGCCTGACTGG + Intergenic
1142332182 16:89462224-89462246 CTCACGCCGCCACGCCTGACTGG + Intronic
1142533463 17:598116-598138 CTCGCGCCGCCACACCTGACTGG + Intronic
1142705405 17:1690460-1690482 CTCGCGCCGCCACGCCTGACTGG - Intergenic
1142995039 17:3755147-3755169 CTGCCGCCGCCGCCGCTGTCTGG + Exonic
1143283287 17:5771105-5771127 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1143460577 17:7101027-7101049 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1143664355 17:8347619-8347641 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1143689510 17:8549843-8549865 CTCGCGCCGCCACGCCTGACTGG + Intronic
1145209502 17:21002921-21002943 CTCCCGCCGCCTCCCCGGCCTGG - Exonic
1145251394 17:21298732-21298754 CTCCGGCCACCTCCTCTCACTGG - Intronic
1146740545 17:35279413-35279435 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1146917998 17:36690440-36690462 CTCCAGCCGCTGCCTCTGCTGGG - Intergenic
1147373546 17:40010794-40010816 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1147674178 17:42193414-42193436 CTCCAGCCTCCGCCGCTGCCAGG + Exonic
1147727825 17:42577653-42577675 CTCCCGCCGCAGCTTCTGCCCGG + Exonic
1147819658 17:43234243-43234265 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147821774 17:43246130-43246152 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147822866 17:43252285-43252307 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147825384 17:43267089-43267111 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147826507 17:43273556-43273578 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147827396 17:43278434-43278456 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147828504 17:43284595-43284617 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147829613 17:43290747-43290769 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147831390 17:43300497-43300519 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1148016790 17:44527826-44527848 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1148023299 17:44568078-44568100 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1148534081 17:48423864-48423886 CTCCCACCTCCGCCTCTCAAAGG + Intronic
1148764829 17:50031523-50031545 CTCCCACCTCAGCCTCTTACAGG - Intergenic
1149658909 17:58324444-58324466 CTCCCGCCGCCGCCGTAGAGCGG - Intronic
1150772210 17:68051734-68051756 CTCTCGGCACCGCCTCTGCCTGG + Intergenic
1150786816 17:68169856-68169878 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1150804681 17:68309406-68309428 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1151123589 17:71820352-71820374 CTCCTGCCTCCGCCTCTTGCAGG - Intergenic
1152128997 17:78465085-78465107 CTCGCGCCGCCACGCCTGACTGG + Intronic
1152241655 17:79164211-79164233 CTACCGCCACCGCCCCTGCCAGG - Intronic
1152357323 17:79813493-79813515 CCGCCCCCGCCGCCTCTGTCTGG - Intergenic
1152864985 17:82717016-82717038 CTGCCGCCGCCGCCCCTTGCGGG + Intronic
1153556252 18:6316841-6316863 CTCCCCCAGCCACCTCTGTCAGG + Intronic
1153633917 18:7098004-7098026 CTCGCGCCGCCACGCCTGACTGG + Intronic
1154255391 18:12777351-12777373 CTCTCGGCGCCTCCTCTGTCTGG - Intergenic
1156095942 18:33531682-33531704 CTCCCCCAGCCCCCTCTGACAGG - Intergenic
1158351840 18:56572151-56572173 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1158836444 18:61335126-61335148 CTTCCTCAGCCGCCTCTGGCTGG + Intronic
1159230716 18:65605115-65605137 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1159340594 18:67127517-67127539 CTCGCGCCGCCACGCCTGACTGG - Intergenic
1159473027 18:68880494-68880516 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1160176699 18:76600629-76600651 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1160861056 19:1237400-1237422 CTCCCGCAGCCGCCTCCCCCAGG - Intronic
1160910749 19:1472755-1472777 CTCCCACCGCGGCCCCTGCCTGG + Exonic
1160930343 19:1567224-1567246 GCCCCGCCGCCGCCTTTGTCTGG - Intronic
1160996688 19:1885322-1885344 CGCCCGCCCCCGCCCCTGCCCGG + Intronic
1161293113 19:3506358-3506380 CGGCCGCGGCCGCCGCTGACGGG - Intronic
1162237571 19:9321261-9321283 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1162909833 19:13842811-13842833 CTCCGGCCGCCGCCCCGGGCCGG + Intergenic
1163181801 19:15609144-15609166 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1163218728 19:15899191-15899213 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1163681245 19:18683851-18683873 CTCCCTCCGCCGGCCCTGAAGGG - Intronic
1164270666 19:23669026-23669048 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1164834536 19:31349245-31349267 CCGCCGCCGCCGCCGCTGCCGGG + Exonic
1165266859 19:34668055-34668077 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1165498135 19:36166281-36166303 CTCCCGCCTGAGCCTCTGAAGGG + Intergenic
1167038655 19:47009274-47009296 CTCGCGCCGCCACGCCTGACTGG + Intergenic
1167347334 19:48954898-48954920 CTCCCGCCGCCGCCTCTCGCCGG - Intronic
1167748400 19:51366328-51366350 TTCCCGCCGCAGCCACTTACAGG + Intronic
1168023266 19:53625295-53625317 CTCCCGCCTCGGCCTCTCACTGG + Intergenic
1168346228 19:55651412-55651434 CTTCTGCCGCCTCCTCTCACTGG - Exonic
924998896 2:388189-388211 CTCCTGCCACTGCCTCTGGCTGG + Intergenic
925099049 2:1230094-1230116 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
925134323 2:1515793-1515815 CCCCAGCCGCTGCCTCTGTCTGG + Intronic
925637830 2:5959343-5959365 CTCCCCCAGCTGCCTCTGTCAGG - Intergenic
925906550 2:8543202-8543224 GTCCTGCCCCCGCCTCTGAGGGG + Intergenic
926215689 2:10903708-10903730 CTCACGCCGCCACGCCTGACTGG - Intergenic
926225081 2:10961505-10961527 CTCCAGCTGCTGCCTCTGTCTGG + Intergenic
926850595 2:17193415-17193437 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
927777728 2:25915362-25915384 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
928701616 2:33904011-33904033 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
929379610 2:41335451-41335473 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
929966985 2:46543296-46543318 CCCCCGCCGCGCCCTCTGCCAGG + Intronic
930037937 2:47099593-47099615 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
930485430 2:52006660-52006682 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
931513465 2:63025369-63025391 CTCCCGCCTCAGGCTCTGAGTGG + Intronic
931576258 2:63721884-63721906 CTCGCGCCGCCACGCCTGACTGG + Intronic
932521699 2:72421689-72421711 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
933442150 2:82326694-82326716 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
933465698 2:82648161-82648183 CTCTCCCCACCCCCTCTGACAGG - Intergenic
934638349 2:96010711-96010733 CTGCCGCCGCCGCCGCCGCCAGG + Intergenic
934795306 2:97094700-97094722 CTGCCGCCGCCGCCGCCGCCAGG - Exonic
934880984 2:97978626-97978648 CTCCCGCCTAGGCCTCTGAAAGG + Intronic
935896934 2:107747836-107747858 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
936456184 2:112675982-112676004 CTCCCGCCTCAGCCTCTTAAAGG - Intergenic
936581610 2:113704904-113704926 CTCTCCCCGCCTCCTCTGCCTGG - Intergenic
937168905 2:119845093-119845115 CTCGCGCCGCCACGCCTGACTGG - Intronic
937734991 2:125277634-125277656 CCCGCGCCGCCACATCTGACTGG - Intergenic
938726107 2:134109848-134109870 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
938931278 2:136088522-136088544 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
939281678 2:140073657-140073679 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
939432657 2:142130784-142130806 CTGCCGCCGCCGCCGCCGCCGGG - Exonic
940215025 2:151295870-151295892 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
940635442 2:156293017-156293039 CTCGCGCCGCCACGCCTGACTGG + Intergenic
940639950 2:156334461-156334483 CTGCCGCCGCCGCCGCTGCTCGG + Intronic
940666783 2:156618559-156618581 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
940817427 2:158311322-158311344 CTCGCGCCGCCACGCCTGACTGG - Intronic
943680429 2:190761463-190761485 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
943906189 2:193502908-193502930 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
944228357 2:197370433-197370455 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
944843210 2:203643326-203643348 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
944858011 2:203786075-203786097 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
947026552 2:225743990-225744012 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
947411911 2:229850579-229850601 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
948256034 2:236568516-236568538 GTCCCGCCACCGCCTCTGCAGGG - Intronic
948449194 2:238058357-238058379 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
948461955 2:238134120-238134142 CTCCAGCCCCCTCCTCTGTCAGG - Intergenic
1169365170 20:4986215-4986237 CTCCTGCCCCCGCCTCTGCTGGG - Intronic
1169849115 20:10031542-10031564 CTCCAGGCGCCTCCTCTGCCTGG + Intronic
1170246396 20:14226371-14226393 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1170989806 20:21291735-21291757 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1171292931 20:23992975-23992997 CTCCCGCCTCAGCCTCTCAAAGG - Intergenic
1171958122 20:31475245-31475267 CTCCCCTCGCCGCCTCGGCCGGG - Intronic
1172431938 20:34899302-34899324 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1172889263 20:38252571-38252593 TTCCTGCCGCCCCCTCTGCCTGG + Intronic
1173243432 20:41317603-41317625 CCGCCGCCGCCGCCTCTGCGGGG - Intronic
1173601519 20:44298994-44299016 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1174494597 20:50930871-50930893 CCGCCGCCGCCGCCGCTGTCCGG - Exonic
1175361601 20:58415065-58415087 CTCGCGCCGCCACGCCTGACTGG - Intronic
1175429525 20:58891677-58891699 CGCCCGCCGCCGCCGCAGCCCGG + Intronic
1175820624 20:61907063-61907085 CTCCCACCACCACCTCTGCCTGG + Intronic
1175856279 20:62122542-62122564 CGCCCGCCGCCGCCTCCGCCTGG - Exonic
1175983815 20:62754457-62754479 CCCCCGACCCTGCCTCTGACTGG - Intronic
1176085936 20:63295525-63295547 TTCCCACCGCCGCCTCCCACTGG + Intronic
1177866726 21:26521025-26521047 CTCCCTCCGCACCCCCTGACGGG - Intronic
1178074102 21:29000037-29000059 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1178075372 21:29010812-29010834 CGCGCGCCGCCACCCCTGACTGG + Intronic
1178082289 21:29077617-29077639 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1178744562 21:35236552-35236574 CTCCTGCCTCAGCCTCTGACGGG + Intronic
1179381974 21:40908298-40908320 CTCCCTCCCCTGCCTCTCACTGG + Intergenic
1179810984 21:43869608-43869630 CTCCCTCCGCCTCCTCTCACGGG - Intronic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181399059 22:22640257-22640279 CTCCCGCCTCGGCCTCTCAAAGG + Intergenic
1181501787 22:23319603-23319625 CTCCCGCCTCAGCCTCTCAAAGG + Intergenic
1181650362 22:24255802-24255824 CTCCCGCCTCGGCCTCTCAAAGG - Intergenic
1181707017 22:24654936-24654958 CTCCCGCCTCAGCCTCTCAAAGG + Intergenic
1183054026 22:35290519-35290541 CTCCTGCCTCAGCCTCTCACAGG - Intronic
1183063277 22:35348164-35348186 CTCCAGCCACCGCCCCTGCCCGG + Intergenic
1183247213 22:36703232-36703254 CCGCCGCCGCCGCCGCTGCCCGG - Exonic
1183422203 22:37718339-37718361 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1184150738 22:42636930-42636952 CTCACGCTGCCCCCTCTGCCAGG + Intronic
1184679271 22:46061658-46061680 CGCGTGCCGCCGCCTCTGCCCGG + Intronic
1184721747 22:46318669-46318691 CTCCTGCCGTTGCCTCTGCCTGG - Intronic
1185000900 22:48244918-48244940 CTCCAGCCGCCGACACTGCCCGG + Intergenic
1185026457 22:48416855-48416877 CTCCAGCCAGCACCTCTGACAGG + Intergenic
1185156216 22:49195025-49195047 CTCCCGGCTCCGCCTCTCGCTGG + Intergenic
1185218427 22:49616740-49616762 CTCCCGACGGCGCCTGTGCCTGG - Intronic
1185218434 22:49616766-49616788 CTCCCGACGCTGCCTGTGCCTGG - Intronic
1185218447 22:49616818-49616840 CTCCCGACGCCGCCTGTGCCTGG - Intronic
1185255075 22:49827417-49827439 CCGCCGCCGCCGCCTCGGCCCGG - Intronic
1185291578 22:50030276-50030298 CTCCCGCCGGCGCCTCCGTCAGG + Intronic
1185313798 22:50170394-50170416 CCCCCGCCGCCGCCCCGGCCCGG + Intergenic
949929508 3:9067639-9067661 CTCCCGCCGCCTCCCCTGACAGG - Intronic
949970241 3:9397671-9397693 CCGCCGCCGCCGCCGCTGCCGGG + Intronic
950470092 3:13179616-13179638 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
950829367 3:15859448-15859470 CTGCCGCTGCCGCCGCCGACCGG + Exonic
952398157 3:32939544-32939566 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
952713236 3:36453206-36453228 CTCCCGGCGCCTCCTCTGCCTGG + Intronic
952867191 3:37862003-37862025 CTCCCGCCGCCGCCGCCGCTGGG - Intronic
954040929 3:47887067-47887089 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
955186347 3:56718795-56718817 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
955266535 3:57449845-57449867 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
955674702 3:61435569-61435591 CTCGCGCCGCCACGCCTGACTGG - Intergenic
957002338 3:74900433-74900455 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
957009261 3:74985625-74985647 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
957419746 3:79951870-79951892 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
957560238 3:81812482-81812504 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
957665262 3:83218110-83218132 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
957804988 3:85134360-85134382 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
957830102 3:85505174-85505196 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
958782395 3:98558302-98558324 CTCCCTCCCCCGACTCTGACAGG + Intronic
959422667 3:106148488-106148510 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
960149882 3:114238789-114238811 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
961260103 3:125595362-125595384 CTCCCGGGGCCGCCTCTCCCAGG + Intergenic
961322268 3:126084098-126084120 TTCCCGCCGCCGCCTGGGAGGGG - Exonic
961418683 3:126782004-126782026 CACCCGCCAACTCCTCTGACTGG - Intronic
962277962 3:134030051-134030073 CCGCCGCCGCCCCCTCAGACAGG + Exonic
963440332 3:145333255-145333277 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
963743079 3:149098348-149098370 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
964378457 3:156073022-156073044 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
964720380 3:159763835-159763857 CTCCCGCCTCCGCGTCTCCCTGG - Intronic
965040221 3:163498885-163498907 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
965044209 3:163552820-163552842 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
965203193 3:165687260-165687282 CGCCCGCCTCCGCCTCTCAAAGG - Intergenic
965220285 3:165918945-165918967 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
965245316 3:166258967-166258989 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
965298050 3:166975695-166975717 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
965823873 3:172711107-172711129 CTCCCGACGCAGCCTCTGATTGG - Exonic
965837291 3:172866645-172866667 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
966191094 3:177272226-177272248 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
966378799 3:179323238-179323260 CGGCCGCCGCCGCCTCTGCGTGG + Intronic
966982702 3:185152940-185152962 CTCCCGCCGCCGCCGCGTGCTGG - Exonic
967278431 3:187799064-187799086 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
967718266 3:192788893-192788915 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
968438825 4:611174-611196 CTGCCTCAGCCGCCTCTGCCTGG - Intergenic
968493383 4:902358-902380 CACCCGCCTCAGCCTCTGAAAGG - Intronic
968549338 4:1214258-1214280 CTCCAGACGGCGCCTCTGCCAGG - Intronic
968716084 4:2161131-2161153 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
968999045 4:3965192-3965214 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
970673240 4:18418837-18418859 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
971377198 4:26064479-26064501 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
971639743 4:29117214-29117236 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
971905270 4:32716724-32716746 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
972774181 4:42226339-42226361 CTCCGGCTGCTGCCTCTGCCTGG + Intergenic
973190388 4:47378553-47378575 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
973673317 4:53239201-53239223 CTCGCGCCGCCACGCCTGACTGG - Intronic
973760196 4:54108489-54108511 CTCCCTCCGGCGCCACCGACGGG - Intronic
975673294 4:76802814-76802836 CTCCTCCCGCCGCCTCTCTCAGG - Intergenic
975755801 4:77570526-77570548 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
975992022 4:80267205-80267227 CTTCCGCGGCCGCCTAGGACGGG - Intronic
977206437 4:94169702-94169724 CTCCCGGCGCCTCCTCTGCCTGG + Intergenic
978080115 4:104581656-104581678 CTCTCGGCGCCTCCTCTGACTGG + Intergenic
978999651 4:115200695-115200717 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
979825783 4:125230088-125230110 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
979899794 4:126201789-126201811 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
980052012 4:128048057-128048079 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
980230326 4:130039041-130039063 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
980799688 4:137733598-137733620 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
981284385 4:142998253-142998275 CTCCCACCTCAGCCTCTTACAGG + Intergenic
981300913 4:143185115-143185137 CTCCCGCCGACGCCGCTGGGGGG + Exonic
982728113 4:158927563-158927585 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
983553131 4:169036334-169036356 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
984192912 4:176625659-176625681 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
984662177 4:182386422-182386444 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
984770494 4:183433036-183433058 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
984776186 4:183483162-183483184 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
984811215 4:183797754-183797776 CCCCCGCCGGCGCCTCTGCCGGG - Intergenic
984948804 4:184990587-184990609 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
985087017 4:186324446-186324468 CTCCTGGCGCCTCCTCTGCCTGG + Intergenic
985145354 4:186889977-186889999 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
985195251 4:187421447-187421469 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
985203169 4:187505493-187505515 CTCTCGGCGCCCCCTCTGCCTGG + Intergenic
986402885 5:7396338-7396360 CGCCCGCCGCCTCCTCGGAGCGG - Exonic
986697922 5:10375020-10375042 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
986912608 5:12574973-12574995 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
986993210 5:13578395-13578417 CTCTCGACGCCTCCTCTGCCTGG + Intergenic
987268147 5:16277700-16277722 CTCGCGCCGCCACGCCTGACTGG - Intergenic
987283657 5:16436045-16436067 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
987896217 5:23951138-23951160 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
988177180 5:27743323-27743345 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
988369169 5:30345590-30345612 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
989346722 5:40438521-40438543 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
989511555 5:42293818-42293840 CTCCTGCCACAGCCTCTGAGTGG - Intergenic
990490003 5:56295214-56295236 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
991598032 5:68324404-68324426 CGCGCGCCGCCACGTCTGACTGG - Intergenic
992184589 5:74231863-74231885 CTCCTGCTGCCACCTCTGGCTGG - Intergenic
992529178 5:77638854-77638876 CTGCCGCCGCCGCCTCCTTCAGG - Exonic
993328656 5:86570022-86570044 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
994043714 5:95285027-95285049 CAGCCGCCCCCGCCGCTGACAGG - Intergenic
994928749 5:106154168-106154190 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
994935220 5:106246124-106246146 CTCTCGGCGCCTCCTCTGTCTGG + Intergenic
995193147 5:109340795-109340817 CTCGCGCCGCCACACCTGACTGG + Intronic
995568597 5:113457006-113457028 CTCTCACCGCCTCCTCTGCCTGG + Intronic
995656433 5:114432543-114432565 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
996106972 5:119516966-119516988 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
996435613 5:123430409-123430431 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
996442922 5:123512316-123512338 CTCCTACCGCCGCCGCTGGCCGG - Intronic
997297526 5:132777269-132777291 CTCCCGCCGCCGCCGCCAAGGGG - Exonic
997304896 5:132829990-132830012 CGCCCGCGGCCGCCTCTCCCCGG - Intronic
998233090 5:140374069-140374091 CTCCTGCCTCAGCCTCTTACAGG - Intronic
999272208 5:150303017-150303039 CTCCAGCGCCCGCCCCTGACCGG + Intronic
999641143 5:153674478-153674500 CTCCCTCCTCCCCCTCTCACAGG + Exonic
1000065960 5:157693701-157693723 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1000115736 5:158151794-158151816 CTCCCCCCACCGCCCCTGTCGGG + Intergenic
1001054165 5:168435653-168435675 CTCCCGCCTCAGCCTCTCAAAGG + Intronic
1001105692 5:168852183-168852205 CTCCCTCCTGCGCCTCTGCCGGG - Intronic
1002004710 5:176222523-176222545 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1002221667 5:177688097-177688119 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1002273093 5:178085724-178085746 CTCCCGCCTCAGCCTCTGCCCGG - Intergenic
1002291863 5:178205421-178205443 CTCCCTCCTCCGCCTCTCCCGGG + Intronic
1002789454 6:426698-426720 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1002907099 6:1457467-1457489 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1003053738 6:2801440-2801462 CTGCCTCCACCGCCTCTGCCTGG - Intergenic
1003170926 6:3721263-3721285 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1003508909 6:6762978-6763000 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1003577964 6:7315080-7315102 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1003747932 6:9024140-9024162 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1003770234 6:9290934-9290956 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1003982546 6:11403080-11403102 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1003995680 6:11537791-11537813 GTGCCGCCGCAGCCTCTGGCTGG + Intergenic
1004036880 6:11932887-11932909 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1004053231 6:12108888-12108910 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1004233774 6:13855213-13855235 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1004486345 6:16069685-16069707 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1004665600 6:17745802-17745824 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1004861449 6:19807466-19807488 CTCTCGTCGCCTCCTCTGCCTGG - Intergenic
1004907004 6:20245268-20245290 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1005059210 6:21761021-21761043 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1005596287 6:27381556-27381578 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1005600952 6:27425326-27425348 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1005707523 6:28469851-28469873 CTCTCGGCGCCGCCTCTGCCTGG - Intergenic
1005725129 6:28640240-28640262 CTCTCGGCGCCTCCTCTGCCGGG - Intergenic
1006033557 6:31195323-31195345 CTCTCCCCGCCTCCTCTGCCTGG + Intergenic
1006101717 6:31689780-31689802 CTCCTGCAGCCACCTATGACAGG + Intronic
1006263320 6:32894846-32894868 CTCCCGCCGCCTGCACTGAAAGG + Intergenic
1006913299 6:37578290-37578312 CTCCGGCTGCTGCCTCTGCCTGG - Intergenic
1007391781 6:41553545-41553567 CTCCTGCCCCCACCTCTGAAAGG - Intronic
1007481599 6:42153883-42153905 CCCCTGCCACAGCCTCTGACCGG - Intergenic
1007738659 6:43997960-43997982 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1008005667 6:46406264-46406286 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1008038706 6:46774462-46774484 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1008270263 6:49482321-49482343 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1008270564 6:49483915-49483937 CTCCTGGCGCCTCCTCTGCCTGG - Intronic
1009402759 6:63275428-63275450 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1009407173 6:63326952-63326974 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1010235726 6:73573034-73573056 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1011246449 6:85325841-85325863 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1011513969 6:88131952-88131974 CTCCTGCCTCAGCCTCTGAGTGG - Intergenic
1011594409 6:89002664-89002686 CTCCCACCGCAGCCTCTCACAGG + Intergenic
1011620159 6:89234944-89234966 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1011762781 6:90586703-90586725 GCCCCGCCCCCGCCTCTGCCTGG - Intronic
1012189413 6:96261443-96261465 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1013081804 6:106819413-106819435 CTCCAGCCTCAGCCTCTGAGTGG - Intergenic
1013155802 6:107490253-107490275 CTCCCGCCGCCGCCGCCGCCGGG - Exonic
1013193259 6:107821830-107821852 CTCCAGCCACCACCTCTGCCTGG + Intronic
1013694892 6:112689889-112689911 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1013960018 6:115888967-115888989 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1014055815 6:117014623-117014645 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1014240669 6:119015186-119015208 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1014788394 6:125644314-125644336 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1014921150 6:127215089-127215111 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1015148926 6:130018508-130018530 CCGCCGCCGCCGCCGCTGCCGGG - Exonic
1016482391 6:144495641-144495663 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1017537294 6:155362914-155362936 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1017672411 6:156779288-156779310 CCGCCGCCGCCGCCTGGGACTGG - Exonic
1017839583 6:158210286-158210308 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1018545598 6:164933162-164933184 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1018934936 6:168267800-168267822 CTCCCTCTGTCCCCTCTGACAGG + Intergenic
1019524960 7:1476714-1476736 CTCCCAGCGCCGGCTCTGACTGG - Intronic
1019674291 7:2302247-2302269 CTCGCGCCGCCACGCCTGACTGG + Intronic
1019965824 7:4497424-4497446 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1020105655 7:5421182-5421204 CCCCCGCCGCCGCTGCTGTCCGG - Exonic
1020149909 7:5673968-5673990 CTCCTGCCTCAGCCTCTGAGTGG + Intronic
1020552349 7:9621944-9621966 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1020557959 7:9693171-9693193 CTCCTGCCACCACCTCTGTCTGG - Intergenic
1020727340 7:11832144-11832166 CCGCCGCCGCCGCCTCTGGCGGG + Exonic
1022700189 7:32753317-32753339 CTCGCGCCGCCACGCCTGACTGG + Intergenic
1023965812 7:44962605-44962627 CTCCGGCCGCCTCCTCGGTCAGG - Intergenic
1024471709 7:49773596-49773618 CTGCCGCAGCCGCCTCCGCCCGG - Intergenic
1025069707 7:55887692-55887714 CTCCCGCCTCCGCCTCCTCCCGG - Intronic
1026047978 7:66921250-66921272 CTCCCGCCGCCGCCTCAGTTCGG - Exonic
1026868067 7:73835368-73835390 CTCGCGCCGCCACGCCTGACTGG + Intronic
1027238086 7:76309934-76309956 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1027667605 7:81057974-81057996 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1028558106 7:92143823-92143845 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1028919443 7:96294785-96294807 CTCCTGCCTCAGCCTCTCACTGG + Intronic
1029809699 7:103034701-103034723 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1029988088 7:104940019-104940041 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1030102189 7:105956255-105956277 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1030367090 7:108657714-108657736 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1030780334 7:113593182-113593204 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1030819397 7:114077340-114077362 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1031378721 7:121059832-121059854 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1032193971 7:129779513-129779535 CTCCCGCCCCCGCCCCCGCCCGG + Intergenic
1032561685 7:132899105-132899127 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1033654138 7:143362098-143362120 CCCCCGCCGCCGCCTCCATCTGG - Intronic
1034224934 7:149474850-149474872 CTGCCGCCACCGCCTGTGCCCGG + Exonic
1034632214 7:152539358-152539380 CTCTCGGCGCCTCCTCTGTCTGG - Intergenic
1034656121 7:152730774-152730796 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1034967188 7:155398647-155398669 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1034977714 7:155457896-155457918 CTCCGGCCGCCGCCGCCGCCCGG - Intergenic
1035417848 7:158704772-158704794 CACCCGCCGGCGCCCCAGACGGG + Exonic
1035662179 8:1356441-1356463 CGCCCACTGCAGCCTCTGACGGG - Intergenic
1035999167 8:4582689-4582711 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1036441112 8:8781889-8781911 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1036554725 8:9848254-9848276 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1036737065 8:11329458-11329480 CTCGCGCCGCCACGCCTGACTGG + Intergenic
1036786738 8:11692820-11692842 CGGCCGCCCCCGCCTCTGCCCGG - Intronic
1036851380 8:12203862-12203884 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1036872744 8:12446136-12446158 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1036910647 8:12754943-12754965 CGCCCGCTGCCGCCTCTGCCGGG - Exonic
1037810893 8:22086416-22086438 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1037957632 8:23071286-23071308 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1038152659 8:24956535-24956557 CTCCCACCGCCGCCGCGGGCCGG - Exonic
1038536435 8:28356529-28356551 CTCCCACTGGCACCTCTGACCGG - Intronic
1038639326 8:29311327-29311349 CTCTCGGCGCCACCTCTGCCTGG + Intergenic
1039340734 8:36647079-36647101 CGCCCGCCACCGCATCCGACTGG + Intergenic
1039587539 8:38719727-38719749 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1039846320 8:41328209-41328231 CTCCCGCCTCCGGGTCTGATTGG + Intergenic
1039973359 8:42338817-42338839 CTCCCTCCGGCGCCCCTGGCTGG + Intronic
1040035180 8:42863071-42863093 CACAGGCTGCCGCCTCTGACTGG - Intronic
1040055729 8:43055882-43055904 CTCCCGCCGCGGCCTCCGAGCGG + Intronic
1041280917 8:56210886-56210908 CTCCCGAAGTCGCTTCTGACAGG - Intronic
1041919801 8:63168835-63168857 CCGCCGCCGCCGCCGCTGCCTGG - Exonic
1042040116 8:64581028-64581050 CTGCCGCCGCCGCCTCCTCCAGG - Exonic
1043346381 8:79303356-79303378 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1043496317 8:80804670-80804692 CTCCCACCTCCCACTCTGACAGG - Intronic
1043769678 8:84183082-84183104 CTGCCGCCGCCGCCTCGCATTGG - Intronic
1044088414 8:87971016-87971038 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1044404817 8:91816226-91816248 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1044582363 8:93835074-93835096 CACGCGCCGCCACTTCTGACTGG - Intergenic
1044627275 8:94246242-94246264 CTCCTGCCTCAGCCTCTGAGTGG - Intergenic
1046149425 8:110203069-110203091 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1046208962 8:111041336-111041358 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1048136205 8:131748778-131748800 CCCCCGCACCCTCCTCTGACAGG + Intergenic
1048757574 8:137755616-137755638 CGCTCGGCGCCTCCTCTGACTGG - Intergenic
1048789097 8:138083997-138084019 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1049087717 8:140491013-140491035 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1049172888 8:141173006-141173028 CAGCCACCTCCGCCTCTGACTGG - Intronic
1049172896 8:141173036-141173058 CAGCCACCTCCGCCTCTGACTGG - Intronic
1049555364 8:143278815-143278837 CTCCCGCAGCGGCAGCTGACGGG + Intergenic
1049602325 8:143513672-143513694 CTGCGGACGCTGCCTCTGACTGG - Intronic
1049682174 8:143924286-143924308 CTCCAGCCGCCGCCGCTGGAAGG + Exonic
1050042582 9:1511735-1511757 CTCCTGCCTCAGCCTCTGAGTGG + Intergenic
1050433109 9:5582056-5582078 CTCCTACCCCCGCTTCTGACAGG - Intergenic
1050678012 9:8078408-8078430 CTCCCCTCGCCCCCACTGACAGG - Intergenic
1050920545 9:11196741-11196763 CTCTCGGCGCCTCCTCTGTCTGG + Intergenic
1051305167 9:15700540-15700562 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1051383221 9:16480370-16480392 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1051641808 9:19230696-19230718 CGGCCGCCGCCGCCTCAGTCCGG - Exonic
1053436018 9:38075233-38075255 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1053467861 9:38324180-38324202 CTCGCGCCGCCACGCCTGACTGG + Intergenic
1055557655 9:77490881-77490903 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1055841755 9:80513600-80513622 CTCCCACCCCCACCTCTGATAGG + Intergenic
1056081046 9:83093805-83093827 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1056154137 9:83817809-83817831 CTCACGCCGCCTCCTCCGCCCGG - Intronic
1056216197 9:84408341-84408363 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1056356364 9:85805288-85805310 CTCACGCCGCCCCCTCCGCCCGG + Intergenic
1057561276 9:96129950-96129972 CACCCGCAGTCACCTCTGACGGG - Intergenic
1057708085 9:97412171-97412193 CTCCTGCCGCCGTCTCCGCCAGG - Exonic
1058018703 9:100067335-100067357 CGCGCGCCGCCGCGCCTGACTGG + Intronic
1058851216 9:109013506-109013528 CTGTCGCCGCCGCCTCGGGCGGG - Exonic
1058908272 9:109498412-109498434 CTCCCGCCCCCGCCCCGGGCTGG + Intergenic
1059305324 9:113349530-113349552 CGCCCGCCGCCACCTGCGACAGG + Exonic
1059791230 9:117643226-117643248 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1060044301 9:120327660-120327682 CTCCCTCCGGCTCCTCTGTCTGG - Intergenic
1060700633 9:125747004-125747026 CCGCCGCCGCCGCCTCGGCCAGG - Intergenic
1060979663 9:127785241-127785263 CTCCCGCCTTCGCCTCTGTGGGG + Intergenic
1061235005 9:129337085-129337107 CTCCCCCCGCCGCCCCTTTCAGG - Intergenic
1062472534 9:136712750-136712772 CGCCCCCGGCCGCCTCTGCCTGG + Intronic
1186152675 X:6691006-6691028 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1186323331 X:8452990-8453012 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1187005925 X:15232230-15232252 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1189057007 X:37708057-37708079 CGCCCGCCGCCACGCCTGACTGG - Intronic
1189407116 X:40735354-40735376 CCCCCGCCGCCGCCTCCGGGCGG + Exonic
1190184395 X:48221933-48221955 CTCGCGCCGCCACGCCTGACTGG + Intronic
1193270991 X:79530436-79530458 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1193804124 X:85972856-85972878 CTCTCGGCGCCTCCTCTGCCTGG - Intronic
1195258109 X:103107849-103107871 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1195630161 X:107047501-107047523 CTCCCACCTCCGCCTCCCACAGG + Intergenic
1195896444 X:109749818-109749840 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1196714530 X:118798817-118798839 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1196794062 X:119488363-119488385 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1198177757 X:134172710-134172732 CTCCGGCCACGGCCTCTGCCTGG - Intergenic
1198299904 X:135325317-135325339 CTCTCGGCGCCTCCTCTGCCTGG + Intronic
1198338991 X:135695029-135695051 CTCCTTCCTCAGCCTCTGACTGG + Intergenic
1198424066 X:136497338-136497360 CCACCGCCGCCGCCGCCGACCGG - Exonic
1198606892 X:138350258-138350280 GTCCCACCGCTGCATCTGACTGG - Intergenic
1198694368 X:139320673-139320695 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1198872377 X:141188998-141189020 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1199010026 X:142746223-142746245 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1199134242 X:144231709-144231731 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic
1199586291 X:149420283-149420305 CTCGCGCCGCCACGCCTGACTGG + Intergenic
1199628037 X:149758440-149758462 CTCTCGGCGCCTCCTCTGCCTGG + Intergenic
1200062167 X:153488500-153488522 CTCCCGCCCCCGCCACAGTCTGG - Intronic
1202137182 Y:21677161-21677183 CTCTCGGCGCCTCCTCTGCCTGG - Intergenic