ID: 1076146486

View in Genome Browser
Species Human (GRCh38)
Location 10:128126289-128126311
Sequence TCCCGCCGCCGCCTCTGACG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076146480_1076146486 -6 Left 1076146480 10:128126272-128126294 CCTGCAGTCCCCGCTGCTCCCGC 0: 1
1: 0
2: 3
3: 71
4: 1103
Right 1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1076146475_1076146486 22 Left 1076146475 10:128126244-128126266 CCGCGGGGTCGCGTTCGCTGCAC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1076146474_1076146486 23 Left 1076146474 10:128126243-128126265 CCCGCGGGGTCGCGTTCGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1076146473_1076146486 29 Left 1076146473 10:128126237-128126259 CCGCAGCCCGCGGGGTCGCGTTC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1076146479_1076146486 -2 Left 1076146479 10:128126268-128126290 CCGGCCTGCAGTCCCCGCTGCTC 0: 1
1: 2
2: 40
3: 696
4: 2581
Right 1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1076146477_1076146486 0 Left 1076146477 10:128126266-128126288 CCCCGGCCTGCAGTCCCCGCTGC 0: 1
1: 0
2: 0
3: 52
4: 594
Right 1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1076146478_1076146486 -1 Left 1076146478 10:128126267-128126289 CCCGGCCTGCAGTCCCCGCTGCT 0: 1
1: 1
2: 11
3: 129
4: 1296
Right 1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG 0: 1
1: 0
2: 0
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076146486 Original CRISPR TCCCGCCGCCGCCTCTGACG GGG Exonic
901325134 1:8361014-8361036 CCCCGCTGCAGCCTCTGACTGGG - Exonic
902323566 1:15684296-15684318 TCCTGCCGCCGCCGCCGCCGCGG + Intergenic
902338087 1:15765262-15765284 CCCCACCTCTGCCTCTGACGTGG - Intronic
904642061 1:31938376-31938398 TCCCGCCGCCGCCCCTCAGGGGG + Exonic
904837747 1:33349917-33349939 TCCCGCGGCCGCCTCCGCCGGGG + Intronic
906480949 1:46198469-46198491 CGCCGCCGCCGCCGCTGCCGCGG + Intronic
906624489 1:47313986-47314008 CCCCGCTGCCGCCTCTCAAGGGG + Intronic
907456503 1:54579723-54579745 TCCCGCCCCTGCCTCTCACAAGG - Intronic
910759003 1:90717598-90717620 CGCCGCCGCCGCCGCTGCCGGGG + Intergenic
914779106 1:150767878-150767900 TCCCGCCTCAGCCTCTGGAGTGG + Intergenic
914869160 1:151458949-151458971 CCCCGCGGCCGCCCCTGCCGCGG + Intronic
915517505 1:156421740-156421762 TCCCTCCTCTGCCTCTGCCGCGG + Intronic
922318883 1:224467134-224467156 TCCCACCCCAGCCTCTCACGTGG + Intronic
922502568 1:226108257-226108279 TCCCACCTCAGCCTCTGAAGTGG + Intergenic
923163412 1:231337385-231337407 AGCCGCCGCCGCCTCTGGAGGGG - Exonic
1062979125 10:1707271-1707293 TCCCTCTGCCTCCTCTGACGAGG - Intronic
1064086582 10:12349977-12349999 TGCCGCCGCCGCCACTACCGCGG + Intronic
1064274197 10:13891771-13891793 CCCCGCCGCCGCCCCCGCCGCGG + Intronic
1067674286 10:48357502-48357524 TCCCACCTCAGCCTCTGAAGTGG + Intronic
1070351080 10:75592642-75592664 TCGCGGAGCCGCGTCTGACGCGG + Intronic
1070570643 10:77637740-77637762 TGCCGCCGCCGCCGCCGCCGCGG + Intronic
1072562232 10:96586897-96586919 CGCCGCCGCCGCCTCCGCCGCGG + Exonic
1074633815 10:115290543-115290565 TCCCGCCTCAGCCTCGGAAGTGG - Intronic
1074843215 10:117375227-117375249 TCCCGCCACCGCCTCCGCCCGGG + Exonic
1076146486 10:128126289-128126311 TCCCGCCGCCGCCTCTGACGGGG + Exonic
1076605999 10:131690182-131690204 GCAGGCCCCCGCCTCTGACGTGG - Intergenic
1076762351 10:132611846-132611868 TCCCACACCCTCCTCTGACGGGG - Intronic
1077168958 11:1157949-1157971 TCCCTCAGCAGCCTCTGAGGAGG - Exonic
1078210331 11:9265159-9265181 TCCCGCCGCCGCCGCTACCGCGG + Exonic
1078774405 11:14381227-14381249 TGCCGCTGGCGCCGCTGACGAGG + Intergenic
1080540434 11:33258512-33258534 TCCCGCCGCCGCTGGGGACGCGG - Intronic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1084129034 11:67119339-67119361 CGCCGCCGCCGCCGCTGCCGGGG - Intronic
1084181962 11:67451327-67451349 GCCCGGGGCCGCCTCTGGCGGGG + Exonic
1084546226 11:69816449-69816471 TCCCGCCGCCCCCACGGAGGGGG + Intronic
1084680110 11:70662060-70662082 TCCCGACGCCGCCGCTGCTGAGG - Intronic
1092572501 12:9740076-9740098 TCTCGGCGCCTCCTCTGCCGGGG - Intergenic
1100618107 12:96247340-96247362 CGCCGCCGCAGCCTCTGACGTGG - Exonic
1103400759 12:120641267-120641289 TCCAGCCGCCGCGTCCGAGGCGG + Exonic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1106226832 13:27792579-27792601 TCCCGCAGCTGCCTCTGCCCAGG - Intergenic
1107836034 13:44413437-44413459 TCTCGGCGCCGCCTCTGCCTGGG + Intergenic
1108690019 13:52851297-52851319 TCCCGGCGCCGCCGCCGTCGTGG - Intergenic
1111951318 13:94711551-94711573 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1115771394 14:36666529-36666551 CCCCGCCGCCGCCCCGCACGCGG + Exonic
1117875778 14:60249214-60249236 CGCCGCCGCCGCCTCTAGCGCGG - Intronic
1118401435 14:65383383-65383405 TCCTGCCTCAGCCTCTCACGTGG + Intergenic
1121050454 14:90816367-90816389 TCCCGCCGCCGCCGCGGGCTCGG + Exonic
1122013101 14:98769923-98769945 TCCCGCCACCGCCTCTCAAGTGG + Intergenic
1123718283 15:23044797-23044819 TCCCCCCGGCACCTCTGACCAGG - Intergenic
1127982756 15:64046502-64046524 TCCAGCCGGCGCCTGGGACGGGG - Intronic
1128067853 15:64775591-64775613 TGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1128455174 15:67827922-67827944 TTCCGCCACCTCCTCTGGCGCGG + Intronic
1131174560 15:90201682-90201704 TGCAGCCGCCGCCTCCGACCTGG + Exonic
1132793377 16:1706197-1706219 CTCCGCCGCCGCCGCTGCCGAGG - Exonic
1132983732 16:2752816-2752838 TCCGCCCGCCGCCTCCGAGGGGG - Exonic
1133335955 16:5006949-5006971 TTCCACCCCCGCCTGTGACGGGG + Intronic
1139459374 16:67109809-67109831 TCCCGCCGCCGTCTCTGCGGAGG - Intergenic
1144547997 17:16215477-16215499 TCCAGCCGCCGCCGCCGCCGCGG + Exonic
1146646665 17:34581058-34581080 TCCCGCCCCCGCCTCGGCCATGG + Exonic
1150390613 17:64788064-64788086 TCCCCCCGCCACCTCTGAAATGG - Intergenic
1152550735 17:81028702-81028724 TCCAGCCGCAGCCACAGACGGGG + Intergenic
1152704321 17:81834895-81834917 ATCCGCCGCCGCCGCTGCCGTGG + Exonic
1152864986 17:82717017-82717039 TGCCGCCGCCGCCCCTTGCGGGG + Intronic
1152919798 17:83060519-83060541 CCACGCGGCCGCCTCTGACACGG - Intergenic
1153201947 18:2655923-2655945 CTCGGCCGCCGCCGCTGACGAGG + Exonic
1155392627 18:25351870-25351892 TGCTGCCGCCGCCGCTGCCGAGG - Intronic
1157377021 18:47176316-47176338 TCCCGCCGCCGCAAGGGACGTGG + Intergenic
1160197742 18:76770637-76770659 CACCGCGGCTGCCTCTGACGTGG + Intergenic
1160930341 19:1567223-1567245 CCCCGCCGCCGCCTTTGTCTGGG - Intronic
1161408409 19:4102944-4102966 ACCCGCCGCCTCCTCCCACGCGG - Intronic
1165236794 19:34428393-34428415 TCCCGCCTCCGCCTCCGCCGCGG + Exonic
1166673451 19:44725221-44725243 CCCCGCCCCCGCCCCTGACCTGG + Intergenic
1167347333 19:48954897-48954919 TCCCGCCGCCGCCTCTCGCCGGG - Intronic
1167748401 19:51366329-51366351 TCCCGCCGCAGCCACTTACAGGG + Intronic
925041511 2:734728-734750 TTCCCGCGCCGCCTCTGACTTGG + Intergenic
929775836 2:44929933-44929955 TCCCGCCGCCTCCTCAGCCAAGG - Intergenic
930011420 2:46941034-46941056 CCCCGCCGCCGCCCCCGCCGCGG - Intronic
930022050 2:47007572-47007594 CCCCGCAGCCGTCTCTGAGGAGG + Intronic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934661419 2:96145532-96145554 GCCCGCCCCCGCCCCTCACGTGG + Intergenic
935692615 2:105744881-105744903 CGCCGCCGCCGCCGCTGCCGCGG + Exonic
937421436 2:121759495-121759517 TCCTGCCTCAGCCTCTGAAGTGG - Intronic
938537187 2:132256622-132256644 CCCCACCGCCGCCACTGTCGCGG + Intronic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
942450899 2:176107580-176107602 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
948200885 2:236129012-236129034 TCCAACCGCTGCCTCAGACGGGG + Exonic
948926592 2:241102496-241102518 CCGTGCCGCCGCCTCTGCCGCGG + Intergenic
1171958121 20:31475244-31475266 TCCCCTCGCCGCCTCGGCCGGGG - Intronic
1172889264 20:38252572-38252594 TCCTGCCGCCCCCTCTGCCTGGG + Intronic
1175578365 20:60079546-60079568 TCCCGCCTGCACCTCTGAGGTGG + Intergenic
1175856278 20:62122541-62122563 GCCCGCCGCCGCCTCCGCCTGGG - Exonic
1175964397 20:62653229-62653251 TCCCGCCACGTCCTCTGCCGAGG - Intronic
1176016799 20:62938111-62938133 CCCCGCCCCCGCCTCCGCCGCGG + Exonic
1179810983 21:43869607-43869629 TCCCTCCGCCTCCTCTCACGGGG - Intronic
1181383632 22:22527376-22527398 TCCTGCCTCGGCCTCTGACATGG + Intergenic
1182567682 22:31212304-31212326 TGCCGCCGCCGCCTCAGGCGCGG - Intronic
1183601701 22:38843889-38843911 CCCCGCCGCCGCGCCTGCCGGGG - Exonic
1184361940 22:44024215-44024237 TCCCGCCCCCGCCCCTGGCCTGG - Intronic
1184425759 22:44408355-44408377 TCCCCCAGACGCCTCTCACGTGG - Intergenic
1184618220 22:45652669-45652691 TCCCGCCTCAGCCTCTGGGGTGG - Intergenic
1185291579 22:50030277-50030299 TCCCGCCGGCGCCTCCGTCAGGG + Intronic
949970242 3:9397672-9397694 CGCCGCCGCCGCCGCTGCCGGGG + Intronic
950555192 3:13691345-13691367 CTCCGCGGCCGCCTCTGATGTGG - Intergenic
952713237 3:36453207-36453229 TCCCGGCGCCTCCTCTGCCTGGG + Intronic
958001865 3:87761182-87761204 TCCCGCCTCAGCCTCTGGAGTGG - Intergenic
961762723 3:129183608-129183630 TGCTGCCGCCGCCTCGGACCCGG - Intronic
961780118 3:129316145-129316167 TCCAGCCGCCGGCTCGGACTCGG - Exonic
968629774 4:1644291-1644313 TCACGCCGAGGCCTCGGACGCGG + Intronic
969858624 4:10019090-10019112 GCCCGGTGCCGGCTCTGACGTGG - Intronic
971257901 4:25030790-25030812 TGCCGCCGCCGCTGCTGGCGAGG + Exonic
972725830 4:41745990-41746012 TGCCGCCGCCGCCGCTGCCGCGG + Exonic
973760195 4:54108488-54108510 TCCCTCCGGCGCCACCGACGGGG - Intronic
977206438 4:94169703-94169725 TCCCGGCGCCTCCTCTGCCTGGG + Intergenic
977607274 4:98995703-98995725 TCCCGCCGCCGCCTCTTCCTCGG + Exonic
978080116 4:104581657-104581679 TCTCGGCGCCTCCTCTGACTGGG + Intergenic
984771959 4:183444314-183444336 TCCCGGCGCCGCAGCTGACCCGG + Intergenic
986152482 5:5140273-5140295 TCCCGCCGCCCCCGCCGCCGCGG + Intergenic
987327331 5:16824299-16824321 TCCCGCCCCCGCCACTGCTGGGG + Intronic
1001084164 5:168688273-168688295 TGCCGCCTCCTCCTCTGACTTGG - Intronic
1001105691 5:168852182-168852204 TCCCTCCTGCGCCTCTGCCGGGG - Intronic
1002291864 5:178205422-178205444 TCCCTCCTCCGCCTCTCCCGGGG + Intronic
1003838814 6:10099181-10099203 AGCCGCCGCTGCCACTGACGAGG + Intronic
1004225539 6:13781219-13781241 TCCCACCTCAGCCTCTGAGGTGG - Intergenic
1004864281 6:19837873-19837895 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1005707522 6:28469850-28469872 TCTCGGCGCCGCCTCTGCCTGGG - Intergenic
1005725128 6:28640239-28640261 TCTCGGCGCCTCCTCTGCCGGGG - Intergenic
1011966270 6:93161499-93161521 TCCCACCTCAGCCTCTGAAGTGG + Intergenic
1015148925 6:130018507-130018529 CGCCGCCGCCGCCGCTGCCGGGG - Exonic
1018400377 6:163414786-163414808 CGCCGCCGCCGCCTGTGCCGCGG - Exonic
1020035014 7:4959306-4959328 CCCCGCCGCCTCCGCTGAGGTGG + Intergenic
1020727341 7:11832145-11832167 CGCCGCCGCCGCCTCTGGCGGGG + Exonic
1021959928 7:25860866-25860888 TCTCCCCGCCGCCTCTGTGGAGG + Intergenic
1023220543 7:37916846-37916868 TCCCGACACCTCCCCTGACGTGG + Exonic
1025007520 7:55365944-55365966 CCCCGCCGCCGCCTCCTCCGAGG - Exonic
1026047977 7:66921249-66921271 TCCCGCCGCCGCCTCAGTTCGGG - Exonic
1026896763 7:74013906-74013928 TCCTGCGGCCGCCTCTGGGGAGG - Intergenic
1027956015 7:84880579-84880601 TCCCGCCGGCGCCTCTCCCTCGG - Intergenic
1029456216 7:100673840-100673862 CGCCGCCGCCGCCTCCGCCGCGG + Exonic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1032174359 7:129611698-129611720 TGCCGCCGCCGCCGCCGCCGAGG - Exonic
1036789498 8:11708666-11708688 GGCCGCCGCCGCCGCTGCCGCGG + Exonic
1037843919 8:22265501-22265523 TCCTGCCTCAGCCTCTGAAGTGG - Intergenic
1048574635 8:135681073-135681095 TCCAGCCACCGCCTCTGGGGAGG - Intergenic
1056154052 9:83817560-83817582 CCCCGCCGCCGCCTCTCCCGCGG + Exonic
1056356445 9:85805533-85805555 CCCCGCCGCCGCCTCTCCCGCGG - Intergenic
1057313379 9:93954990-93955012 GCCCGCAGCCGCCGCTGCCGCGG - Exonic
1060979664 9:127785242-127785264 TCCCGCCTTCGCCTCTGTGGGGG + Intergenic
1061187156 9:129061278-129061300 ACCCGCCGCTGCCTATGAGGAGG + Exonic
1061479874 9:130892360-130892382 TCCGACCGCCGCCTCTGACACGG + Intergenic
1061540792 9:131277118-131277140 TCGTGCGGCCGCCACTGACGGGG - Intergenic
1062030327 9:134359297-134359319 TGCCGCCGGCGGCTCTGAAGTGG + Intronic
1187547313 X:20266716-20266738 CGCCGCCGCCGCCGCTGCCGTGG - Exonic
1198606891 X:138350257-138350279 TCCCACCGCTGCATCTGACTGGG - Intergenic
1198807225 X:140504334-140504356 GGCCGCCGCCGCCGCTGCCGCGG - Exonic