ID: 1076152898

View in Genome Browser
Species Human (GRCh38)
Location 10:128177887-128177909
Sequence CAGCAGAAACGCAGGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152898_1076152917 30 Left 1076152898 10:128177887-128177909 CCCCACAGCCTGCGTTTCTGCTG No data
Right 1076152917 10:128177940-128177962 CCCCATAACCAGGCTGGCCTTGG No data
1076152898_1076152912 24 Left 1076152898 10:128177887-128177909 CCCCACAGCCTGCGTTTCTGCTG No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152898_1076152911 20 Left 1076152898 10:128177887-128177909 CCCCACAGCCTGCGTTTCTGCTG No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data
1076152898_1076152905 -8 Left 1076152898 10:128177887-128177909 CCCCACAGCCTGCGTTTCTGCTG No data
Right 1076152905 10:128177902-128177924 TTCTGCTGCAGGCCAAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152898 Original CRISPR CAGCAGAAACGCAGGCTGTG GGG (reversed) Intergenic