ID: 1076152899

View in Genome Browser
Species Human (GRCh38)
Location 10:128177888-128177910
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152899_1076152905 -9 Left 1076152899 10:128177888-128177910 CCCACAGCCTGCGTTTCTGCTGC No data
Right 1076152905 10:128177902-128177924 TTCTGCTGCAGGCCAAGGGACGG No data
1076152899_1076152917 29 Left 1076152899 10:128177888-128177910 CCCACAGCCTGCGTTTCTGCTGC No data
Right 1076152917 10:128177940-128177962 CCCCATAACCAGGCTGGCCTTGG No data
1076152899_1076152912 23 Left 1076152899 10:128177888-128177910 CCCACAGCCTGCGTTTCTGCTGC No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152899_1076152919 30 Left 1076152899 10:128177888-128177910 CCCACAGCCTGCGTTTCTGCTGC No data
Right 1076152919 10:128177941-128177963 CCCATAACCAGGCTGGCCTTGGG No data
1076152899_1076152911 19 Left 1076152899 10:128177888-128177910 CCCACAGCCTGCGTTTCTGCTGC No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152899 Original CRISPR GCAGCAGAAACGCAGGCTGT GGG (reversed) Intergenic
No off target data available for this crispr