ID: 1076152900

View in Genome Browser
Species Human (GRCh38)
Location 10:128177889-128177911
Sequence TGCAGCAGAAACGCAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152900_1076152917 28 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152917 10:128177940-128177962 CCCCATAACCAGGCTGGCCTTGG No data
1076152900_1076152919 29 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152919 10:128177941-128177963 CCCATAACCAGGCTGGCCTTGGG No data
1076152900_1076152921 30 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152900_1076152911 18 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data
1076152900_1076152905 -10 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152905 10:128177902-128177924 TTCTGCTGCAGGCCAAGGGACGG No data
1076152900_1076152912 22 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152900 Original CRISPR TGCAGCAGAAACGCAGGCTG TGG (reversed) Intergenic