ID: 1076152902

View in Genome Browser
Species Human (GRCh38)
Location 10:128177895-128177917
Sequence TTGGCCTGCAGCAGAAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152902_1076152912 16 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152902_1076152922 25 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152922 10:128177943-128177965 CATAACCAGGCTGGCCTTGGGGG No data
1076152902_1076152919 23 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152919 10:128177941-128177963 CCCATAACCAGGCTGGCCTTGGG No data
1076152902_1076152917 22 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152917 10:128177940-128177962 CCCCATAACCAGGCTGGCCTTGG No data
1076152902_1076152921 24 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152902_1076152911 12 Left 1076152902 10:128177895-128177917 CCTGCGTTTCTGCTGCAGGCCAA No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152902 Original CRISPR TTGGCCTGCAGCAGAAACGC AGG (reversed) Intergenic
No off target data available for this crispr