ID: 1076152905

View in Genome Browser
Species Human (GRCh38)
Location 10:128177902-128177924
Sequence TTCTGCTGCAGGCCAAGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152897_1076152905 -4 Left 1076152897 10:128177883-128177905 CCTGCCCCACAGCCTGCGTTTCT No data
Right 1076152905 10:128177902-128177924 TTCTGCTGCAGGCCAAGGGACGG No data
1076152900_1076152905 -10 Left 1076152900 10:128177889-128177911 CCACAGCCTGCGTTTCTGCTGCA No data
Right 1076152905 10:128177902-128177924 TTCTGCTGCAGGCCAAGGGACGG No data
1076152898_1076152905 -8 Left 1076152898 10:128177887-128177909 CCCCACAGCCTGCGTTTCTGCTG No data
Right 1076152905 10:128177902-128177924 TTCTGCTGCAGGCCAAGGGACGG No data
1076152899_1076152905 -9 Left 1076152899 10:128177888-128177910 CCCACAGCCTGCGTTTCTGCTGC No data
Right 1076152905 10:128177902-128177924 TTCTGCTGCAGGCCAAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152905 Original CRISPR TTCTGCTGCAGGCCAAGGGA CGG Intergenic
No off target data available for this crispr