ID: 1076152906

View in Genome Browser
Species Human (GRCh38)
Location 10:128177914-128177936
Sequence GGTCACAGGGGGCCGTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152906_1076152911 -7 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152911 10:128177930-128177952 TGTGACCCGCCCCCATAACCAGG No data
1076152906_1076152912 -3 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152912 10:128177934-128177956 ACCCGCCCCCATAACCAGGCTGG No data
1076152906_1076152921 5 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data
1076152906_1076152922 6 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152922 10:128177943-128177965 CATAACCAGGCTGGCCTTGGGGG No data
1076152906_1076152917 3 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152917 10:128177940-128177962 CCCCATAACCAGGCTGGCCTTGG No data
1076152906_1076152919 4 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152919 10:128177941-128177963 CCCATAACCAGGCTGGCCTTGGG No data
1076152906_1076152924 18 Left 1076152906 10:128177914-128177936 CCAAGGGACGGCCCCCTGTGACC No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152906 Original CRISPR GGTCACAGGGGGCCGTCCCT TGG (reversed) Intergenic