ID: 1076152909

View in Genome Browser
Species Human (GRCh38)
Location 10:128177927-128177949
Sequence GGTTATGGGGGCGGGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076152909_1076152917 -10 Left 1076152909 10:128177927-128177949 CCCTGTGACCCGCCCCCATAACC No data
Right 1076152917 10:128177940-128177962 CCCCATAACCAGGCTGGCCTTGG No data
1076152909_1076152924 5 Left 1076152909 10:128177927-128177949 CCCTGTGACCCGCCCCCATAACC No data
Right 1076152924 10:128177955-128177977 GGCCTTGGGGGAGAGACCGCCGG No data
1076152909_1076152919 -9 Left 1076152909 10:128177927-128177949 CCCTGTGACCCGCCCCCATAACC No data
Right 1076152919 10:128177941-128177963 CCCATAACCAGGCTGGCCTTGGG No data
1076152909_1076152922 -7 Left 1076152909 10:128177927-128177949 CCCTGTGACCCGCCCCCATAACC No data
Right 1076152922 10:128177943-128177965 CATAACCAGGCTGGCCTTGGGGG No data
1076152909_1076152921 -8 Left 1076152909 10:128177927-128177949 CCCTGTGACCCGCCCCCATAACC No data
Right 1076152921 10:128177942-128177964 CCATAACCAGGCTGGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076152909 Original CRISPR GGTTATGGGGGCGGGTCACA GGG (reversed) Intergenic
No off target data available for this crispr